Incidental Mutation 'R6324:Tnn'
ID510631
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Nametenascin N
SynonymsTnw, tenascin-W
MMRRC Submission
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R6324 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location160085029-160153580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 160145204 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 276 (N276I)
Ref Sequence ENSEMBL: ENSMUSP00000039452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
Predicted Effect probably damaging
Transcript: ENSMUST00000039178
AA Change: N276I

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: N276I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131919
AA Change: N276I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: N276I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 synonymous probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
R7340:Tnn UTSW 1 160146022 missense probably damaging 0.98
R7472:Tnn UTSW 1 160110347 missense probably benign 0.12
R7502:Tnn UTSW 1 160110359 missense probably benign 0.00
R7527:Tnn UTSW 1 160118504 missense possibly damaging 0.51
R7608:Tnn UTSW 1 160088414 nonsense probably null
R7746:Tnn UTSW 1 160114685 missense probably damaging 0.97
R8096:Tnn UTSW 1 160122841 missense probably damaging 1.00
R8136:Tnn UTSW 1 160107060 missense probably damaging 0.96
R8191:Tnn UTSW 1 160125518 missense probably damaging 1.00
R8334:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8335:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8337:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8338:Tnn UTSW 1 160118483 missense probably damaging 1.00
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Z1176:Tnn UTSW 1 160146293 missense probably benign
Z1177:Tnn UTSW 1 160126527 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGTGGTGGCAAGTAGATGC -3'
(R):5'- ATGGTGTGATACGTAATCTGCAC -3'

Sequencing Primer
(F):5'- GCTGGAAATGTCTTTCTTCACG -3'
(R):5'- GTGATACGTAATCTGCACCCTGC -3'
Posted On2018-04-02