Incidental Mutation 'R6324:Atp1a2'
ID510632
Institutional Source Beutler Lab
Gene Symbol Atp1a2
Ensembl Gene ENSMUSG00000007097
Gene NameATPase, Na+/K+ transporting, alpha 2 polypeptide
SynonymsAtpa-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6324 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location172271709-172298064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 172289336 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 238 (R238P)
Ref Sequence ENSEMBL: ENSMUSP00000095072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085913] [ENSMUST00000097464] [ENSMUST00000139528]
Predicted Effect probably damaging
Transcript: ENSMUST00000085913
AA Change: R238P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083077
Gene: ENSMUSG00000007097
AA Change: R238P

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 132 363 2.5e-59 PFAM
Pfam:Hydrolase 368 726 4.5e-19 PFAM
Pfam:HAD 371 723 3.2e-18 PFAM
Pfam:Cation_ATPase 424 518 1.9e-25 PFAM
Pfam:Cation_ATPase_C 796 1005 1.4e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097464
AA Change: R238P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095072
Gene: ENSMUSG00000007097
AA Change: R238P

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.9e-63 PFAM
Pfam:Hydrolase 368 726 2e-32 PFAM
Pfam:HAD 371 723 1.7e-15 PFAM
Pfam:Hydrolase_like2 424 518 1.3e-26 PFAM
Pfam:Cation_ATPase_C 796 947 3.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137679
SMART Domains Protein: ENSMUSP00000117873
Gene: ENSMUSG00000007097

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.2e-63 PFAM
Pfam:Hydrolase 368 613 8.5e-9 PFAM
Pfam:Hydrolase_like2 424 518 5.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139528
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155363
Meta Mutation Damage Score 0.3220 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants die immediately after birth from breathing failure, lack spontaneous respiratory rhythm activity, have elevated levels of extracellular GABA in the brain, and have abnormal chloride homeostasis in brainstem neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Atp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Atp1a2 APN 1 172276002 missense probably damaging 1.00
IGL00954:Atp1a2 APN 1 172290634 missense probably damaging 1.00
IGL01083:Atp1a2 APN 1 172284619 missense probably benign
IGL01372:Atp1a2 APN 1 172278943 missense probably damaging 1.00
IGL01762:Atp1a2 APN 1 172284913 missense possibly damaging 0.89
IGL01896:Atp1a2 APN 1 172286011 missense probably damaging 1.00
IGL01942:Atp1a2 APN 1 172286309 missense probably benign 0.35
IGL01944:Atp1a2 APN 1 172276187 missense probably damaging 0.98
IGL02219:Atp1a2 APN 1 172279718 missense probably damaging 1.00
IGL02219:Atp1a2 APN 1 172279731 nonsense probably null
IGL02304:Atp1a2 APN 1 172289353 missense probably benign
IGL02507:Atp1a2 APN 1 172285771 missense probably damaging 1.00
IGL02557:Atp1a2 APN 1 172278651 missense possibly damaging 0.83
IGL02632:Atp1a2 APN 1 172280614 missense possibly damaging 0.89
IGL03053:Atp1a2 APN 1 172278356 missense probably damaging 1.00
IGL03104:Atp1a2 APN 1 172293367 missense probably damaging 0.97
IGL03161:Atp1a2 APN 1 172278862 intron probably benign
IGL03218:Atp1a2 APN 1 172289303 missense probably null 0.82
PIT4151001:Atp1a2 UTSW 1 172290721 missense probably damaging 0.99
PIT4520001:Atp1a2 UTSW 1 172279374 missense probably benign 0.00
R0121:Atp1a2 UTSW 1 172289342 missense probably damaging 0.99
R0630:Atp1a2 UTSW 1 172291275 missense possibly damaging 0.78
R0682:Atp1a2 UTSW 1 172284597 missense probably benign 0.00
R0755:Atp1a2 UTSW 1 172289381 missense probably benign 0.37
R1413:Atp1a2 UTSW 1 172279344 missense probably damaging 1.00
R1680:Atp1a2 UTSW 1 172278954 missense probably damaging 0.99
R2094:Atp1a2 UTSW 1 172287433 missense probably damaging 1.00
R3714:Atp1a2 UTSW 1 172278984 missense probably damaging 0.96
R4573:Atp1a2 UTSW 1 172278637 missense possibly damaging 0.75
R4928:Atp1a2 UTSW 1 172278387 missense possibly damaging 0.93
R4953:Atp1a2 UTSW 1 172291442 intron probably benign
R5014:Atp1a2 UTSW 1 172284871 missense probably benign 0.05
R5080:Atp1a2 UTSW 1 172284445 intron probably benign
R5129:Atp1a2 UTSW 1 172275955 missense probably benign 0.02
R5360:Atp1a2 UTSW 1 172278869 critical splice donor site probably null
R5619:Atp1a2 UTSW 1 172279381 missense probably damaging 0.99
R5622:Atp1a2 UTSW 1 172291427 intron probably benign
R5718:Atp1a2 UTSW 1 172279442 missense probably damaging 1.00
R5729:Atp1a2 UTSW 1 172293371 missense probably damaging 0.99
R5909:Atp1a2 UTSW 1 172287230 missense probably damaging 1.00
R6018:Atp1a2 UTSW 1 172298012 intron probably benign
R6145:Atp1a2 UTSW 1 172287238 missense probably damaging 1.00
R6164:Atp1a2 UTSW 1 172278892 missense probably damaging 0.97
R6315:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6317:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6319:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6323:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6374:Atp1a2 UTSW 1 172289375 missense probably damaging 1.00
R6764:Atp1a2 UTSW 1 172284614 missense probably benign
R6812:Atp1a2 UTSW 1 172284877 missense probably benign 0.20
R7025:Atp1a2 UTSW 1 172284550 nonsense probably null
R7194:Atp1a2 UTSW 1 172280627 nonsense probably null
R7459:Atp1a2 UTSW 1 172287295 missense probably benign 0.00
R7791:Atp1a2 UTSW 1 172276215 missense probably benign 0.28
R7889:Atp1a2 UTSW 1 172278064 splice site probably null
R7993:Atp1a2 UTSW 1 172291311 missense possibly damaging 0.86
R8183:Atp1a2 UTSW 1 172289351 missense probably damaging 0.96
R8434:Atp1a2 UTSW 1 172284612 missense probably benign 0.01
Z1176:Atp1a2 UTSW 1 172279754 missense possibly damaging 0.90
Z1177:Atp1a2 UTSW 1 172287336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGATTTCCAGCAGAGTCAG -3'
(R):5'- GGTTGAATCTGGCTCAGGAG -3'

Sequencing Primer
(F):5'- GTTCTCCAGAGATGACTACTACCG -3'
(R):5'- TCAGGAGACAGCTGTGTGC -3'
Posted On2018-04-02