Mutagenetix > Incidental Mutations

Incidental Mutation 'R6324:Atp1a2'

510632

Institutional Source

Beutler Lab

Gene Symbol

Atp1a2

Ensembl Gene

ENSMUSG00000007097

Gene Name

ATPase, Na+/K+ transporting, alpha 2 polypeptide

Synonyms

Atpa-3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6324 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

172271709-172298064 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 172289336 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Proline at position 238 (R238P)

Ref Sequence

ENSEMBL: ENSMUSP00000095072 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085913] [ENSMUST00000097464] [ENSMUST00000139528]

Predicted Effect

probably damaging
Transcript: ENSMUST00000085913
AA Change: R238P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000083077
Gene: ENSMUSG00000007097
AA Change: R238P

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
Cation_ATPase_N	40	114	5.28e-19	SMART
Pfam:E1-E2_ATPase	132	363	2.5e-59	PFAM
Pfam:Hydrolase	368	726	4.5e-19	PFAM
Pfam:HAD	371	723	3.2e-18	PFAM
Pfam:Cation_ATPase	424	518	1.9e-25	PFAM
Pfam:Cation_ATPase_C	796	1005	1.4e-45	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000097464
AA Change: R238P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095072
Gene: ENSMUSG00000007097
AA Change: R238P

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
Cation_ATPase_N	40	114	5.28e-19	SMART
Pfam:E1-E2_ATPase	133	364	1.9e-63	PFAM
Pfam:Hydrolase	368	726	2e-32	PFAM
Pfam:HAD	371	723	1.7e-15	PFAM
Pfam:Hydrolase_like2	424	518	1.3e-26	PFAM
Pfam:Cation_ATPase_C	796	947	3.2e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131751

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137679

SMART Domains

Protein: ENSMUSP00000117873
Gene: ENSMUSG00000007097

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
Cation_ATPase_N	40	114	5.28e-19	SMART
Pfam:E1-E2_ATPase	133	364	1.2e-63	PFAM
Pfam:Hydrolase	368	613	8.5e-9	PFAM
Pfam:Hydrolase_like2	424	518	5.7e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139528

SMART Domains

Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

Domain	Start	End	E-Value	Type
IG_like	19	84	3.66e1	SMART
low complexity region	92	103	N/A	INTRINSIC
IG	106	222	2.3e-3	SMART
IG	246	370	9.49e-5	SMART
IG	382	508	3.59e-5	SMART
transmembrane domain	515	537	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155363

Meta Mutation Damage Score

0.3220

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants die immediately after birth from breathing failure, lack spontaneous respiratory rhythm activity, have elevated levels of extracellular GABA in the brain, and have abnormal chloride homeostasis in brainstem neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025F22Rik	T	A	19: 11,163,447	M3L	probably benign	Het
Arhgef4	G	A	1: 34,723,477	A605T	unknown	Het
Atp13a3	A	G	16: 30,332,285	V1069A	possibly damaging	Het
Baz2b	A	G	2: 59,906,948	S1877P	probably damaging	Het
Ccdc114	A	G	7: 45,941,710	E203G	probably damaging	Het
Ccdc27	A	T	4: 154,036,191	S383T	probably benign	Het
Cr1l	A	G	1: 195,111,122	V377A	probably benign	Het
Dazap1	A	G	10: 80,277,660	E130G	probably benign	Het
Dchs1	G	T	7: 105,764,938	A890E	probably benign	Het
Dock10	G	A	1: 80,505,176	T2143I	probably benign	Het
Eif3j1	A	G	2: 122,041,178	D60G	probably benign	Het
Enah	A	G	1: 181,918,571	S382P	probably damaging	Het
Fam171b	A	T	2: 83,879,264	K427*	probably null	Het
Fmn2	A	T	1: 174,612,553	I1179L	possibly damaging	Het
Focad	C	T	4: 88,401,068	R1505*	probably null	Het
Frem1	T	C	4: 82,983,337	T985A	probably benign	Het
Gm3404	A	T	5: 146,528,107	Q219L	possibly damaging	Het
Gm5592	A	C	7: 41,286,535	S154R	probably damaging	Het
Gpn3	C	T	5: 122,372,575		probably benign	Het
Gpr158	A	G	2: 21,810,554	E586G	probably damaging	Het
Gstp2	A	T	19: 4,040,499	I162N	probably benign	Het
Lin7a	T	A	10: 107,380,215		probably null	Het
Loxl4	G	A	19: 42,595,378	L745F	probably benign	Het
Mybpc1	A	G	10: 88,568,619	I172T	possibly damaging	Het
Nalcn	A	G	14: 123,409,749	W571R	possibly damaging	Het
Nkx2-5	G	C	17: 26,841,121	P79A	probably benign	Het
Nufip2	A	G	11: 77,691,661	T134A	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1342	G	A	4: 118,690,531		probably benign	Het
Olfr1463	A	G	19: 13,235,104	M285V	possibly damaging	Het
Phkb	A	G	8: 86,018,542	D616G	probably benign	Het
Plch1	C	T	3: 63,781,390	W131*	probably null	Het
Prl7b1	A	T	13: 27,602,895		probably null	Het
Prop1	G	A	11: 50,952,199	P54S	probably benign	Het
Ptcd3	C	T	6: 71,885,327	V509I	probably benign	Het
Ptprg	T	A	14: 12,226,314	D527E	probably damaging	Het
Rapgef2	C	T	3: 79,079,132	V1182I	probably benign	Het
Rfx7	C	A	9: 72,618,414	P962Q	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Slc38a9	A	G	13: 112,726,100	I444M	probably benign	Het
Sorbs1	T	C	19: 40,321,819	T492A	probably damaging	Het
Synj1	A	T	16: 90,938,630	S1478R	probably benign	Het
Tnn	T	A	1: 160,145,204	N276I	probably damaging	Het
Trbv19	G	A	6: 41,178,758	G21D	probably damaging	Het
Ube2o	A	T	11: 116,539,359	D1184E	probably benign	Het
Vmn1r181	G	A	7: 23,984,758	R216Q	probably benign	Het
Vmn2r108	A	T	17: 20,471,715	L182*	probably null	Het
Vmn2r15	A	G	5: 109,286,271	*856R	probably null	Het
Vmn2r70	G	A	7: 85,558,879	H797Y	probably benign	Het
Zfp11	C	T	5: 129,656,523	A625T	possibly damaging	Het

Other mutations in Atp1a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Atp1a2	APN	1	172276002	missense	probably damaging	1.00
IGL00954:Atp1a2	APN	1	172290634	missense	probably damaging	1.00
IGL01083:Atp1a2	APN	1	172284619	missense	probably benign
IGL01372:Atp1a2	APN	1	172278943	missense	probably damaging	1.00
IGL01762:Atp1a2	APN	1	172284913	missense	possibly damaging	0.89
IGL01896:Atp1a2	APN	1	172286011	missense	probably damaging	1.00
IGL01942:Atp1a2	APN	1	172286309	missense	probably benign	0.35
IGL01944:Atp1a2	APN	1	172276187	missense	probably damaging	0.98
IGL02219:Atp1a2	APN	1	172279718	missense	probably damaging	1.00
IGL02219:Atp1a2	APN	1	172279731	nonsense	probably null
IGL02304:Atp1a2	APN	1	172289353	missense	probably benign
IGL02507:Atp1a2	APN	1	172285771	missense	probably damaging	1.00
IGL02557:Atp1a2	APN	1	172278651	missense	possibly damaging	0.83
IGL02632:Atp1a2	APN	1	172280614	missense	possibly damaging	0.89
IGL03053:Atp1a2	APN	1	172278356	missense	probably damaging	1.00
IGL03104:Atp1a2	APN	1	172293367	missense	probably damaging	0.97
IGL03161:Atp1a2	APN	1	172278862	intron	probably benign
IGL03218:Atp1a2	APN	1	172289303	missense	probably null	0.82
PIT4151001:Atp1a2	UTSW	1	172290721	missense	probably damaging	0.99
PIT4520001:Atp1a2	UTSW	1	172279374	missense	probably benign	0.00
R0121:Atp1a2	UTSW	1	172289342	missense	probably damaging	0.99
R0630:Atp1a2	UTSW	1	172291275	missense	possibly damaging	0.78
R0682:Atp1a2	UTSW	1	172284597	missense	probably benign	0.00
R0755:Atp1a2	UTSW	1	172289381	missense	probably benign	0.37
R1413:Atp1a2	UTSW	1	172279344	missense	probably damaging	1.00
R1680:Atp1a2	UTSW	1	172278954	missense	probably damaging	0.99
R2094:Atp1a2	UTSW	1	172287433	missense	probably damaging	1.00
R3714:Atp1a2	UTSW	1	172278984	missense	probably damaging	0.96
R4573:Atp1a2	UTSW	1	172278637	missense	possibly damaging	0.75
R4928:Atp1a2	UTSW	1	172278387	missense	possibly damaging	0.93
R4953:Atp1a2	UTSW	1	172291442	intron	probably benign
R5014:Atp1a2	UTSW	1	172284871	missense	probably benign	0.05
R5080:Atp1a2	UTSW	1	172284445	intron	probably benign
R5129:Atp1a2	UTSW	1	172275955	missense	probably benign	0.02
R5360:Atp1a2	UTSW	1	172278869	critical splice donor site	probably null
R5619:Atp1a2	UTSW	1	172279381	missense	probably damaging	0.99
R5622:Atp1a2	UTSW	1	172291427	intron	probably benign
R5718:Atp1a2	UTSW	1	172279442	missense	probably damaging	1.00
R5729:Atp1a2	UTSW	1	172293371	missense	probably damaging	0.99
R5909:Atp1a2	UTSW	1	172287230	missense	probably damaging	1.00
R6018:Atp1a2	UTSW	1	172298012	intron	probably benign
R6145:Atp1a2	UTSW	1	172287238	missense	probably damaging	1.00
R6164:Atp1a2	UTSW	1	172278892	missense	probably damaging	0.97
R6315:Atp1a2	UTSW	1	172289336	missense	probably damaging	0.99
R6317:Atp1a2	UTSW	1	172289336	missense	probably damaging	0.99
R6319:Atp1a2	UTSW	1	172289336	missense	probably damaging	0.99
R6323:Atp1a2	UTSW	1	172289336	missense	probably damaging	0.99
R6374:Atp1a2	UTSW	1	172289375	missense	probably damaging	1.00
R6764:Atp1a2	UTSW	1	172284614	missense	probably benign
R6812:Atp1a2	UTSW	1	172284877	missense	probably benign	0.20
R7025:Atp1a2	UTSW	1	172284550	nonsense	probably null
R7194:Atp1a2	UTSW	1	172280627	nonsense	probably null
R7459:Atp1a2	UTSW	1	172287295	missense	probably benign	0.00
R7791:Atp1a2	UTSW	1	172276215	missense	probably benign	0.28
R7889:Atp1a2	UTSW	1	172278064	splice site	probably null
R7993:Atp1a2	UTSW	1	172291311	missense	possibly damaging	0.86
R8183:Atp1a2	UTSW	1	172289351	missense	probably damaging	0.96
R8434:Atp1a2	UTSW	1	172284612	missense	probably benign	0.01
Z1176:Atp1a2	UTSW	1	172279754	missense	possibly damaging	0.90
Z1177:Atp1a2	UTSW	1	172287336	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGATTTCCAGCAGAGTCAG -3'
(R):5'- GGTTGAATCTGGCTCAGGAG -3'

Sequencing Primer
(F):5'- GTTCTCCAGAGATGACTACTACCG -3'
(R):5'- TCAGGAGACAGCTGTGTGC -3'

Posted On

2018-04-02