Incidental Mutation 'R6324:Cr1l'
ID510635
Institutional Source Beutler Lab
Gene Symbol Cr1l
Ensembl Gene ENSMUSG00000016481
Gene Namecomplement component (3b/4b) receptor 1-like
SynonymsmCRY, Crry
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6324 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location195097382-195131586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 195111122 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 377 (V377A)
Ref Sequence ENSEMBL: ENSMUSP00000142309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075451] [ENSMUST00000191775] [ENSMUST00000193094] [ENSMUST00000194062] [ENSMUST00000194111]
Predicted Effect probably benign
Transcript: ENSMUST00000075451
AA Change: V377A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000074902
Gene: ENSMUSG00000016481
AA Change: V377A

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
CCP 42 98 3.51e-6 SMART
CCP 103 160 1.61e-14 SMART
CCP 165 231 7.92e-14 SMART
CCP 237 293 5.23e-14 SMART
CCP 299 355 6.69e-12 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191775
SMART Domains Protein: ENSMUSP00000141250
Gene: ENSMUSG00000016481

DomainStartEndE-ValueType
Pfam:Sushi 1 38 9e-6 PFAM
CCP 43 100 8e-17 SMART
CCP 105 171 3.9e-16 SMART
CCP 177 233 2.6e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193094
AA Change: V377A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142309
Gene: ENSMUSG00000016481
AA Change: V377A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
CCP 42 98 1.7e-8 SMART
CCP 103 160 8e-17 SMART
CCP 165 231 3.9e-16 SMART
CCP 237 293 2.6e-16 SMART
CCP 299 355 3.3e-14 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194062
AA Change: V136A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142104
Gene: ENSMUSG00000016481
AA Change: V136A

DomainStartEndE-ValueType
CCP 1 52 2.9e-9 SMART
CCP 58 114 3.3e-14 SMART
transmembrane domain 123 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194111
AA Change: V339A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142069
Gene: ENSMUSG00000016481
AA Change: V339A

DomainStartEndE-ValueType
CCP 4 60 1.7e-8 SMART
CCP 65 122 8e-17 SMART
CCP 127 193 3.9e-16 SMART
CCP 199 255 2.6e-16 SMART
CCP 261 317 3.3e-14 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194732
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195586
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die by E16.5 with abnormal C3 deposition. Mice homozygous for a null allele activated in single positive thymocytes exhibit T cell lymphopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Cr1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Cr1l APN 1 195129881 missense possibly damaging 0.86
IGL01988:Cr1l APN 1 195117550 missense probably damaging 1.00
IGL02412:Cr1l APN 1 195114772 missense probably damaging 0.97
IGL02412:Cr1l APN 1 195114766 missense probably damaging 1.00
IGL02707:Cr1l APN 1 195123711 missense probably benign 0.03
IGL02726:Cr1l APN 1 195129880 missense probably damaging 1.00
R0105:Cr1l UTSW 1 195112412 splice site probably benign
R0153:Cr1l UTSW 1 195114856 splice site probably benign
R0302:Cr1l UTSW 1 195117793 missense probably damaging 0.99
R1444:Cr1l UTSW 1 195131202 missense probably damaging 0.99
R1760:Cr1l UTSW 1 195114815 missense probably benign 0.01
R2402:Cr1l UTSW 1 195106902 missense probably benign 0.04
R4583:Cr1l UTSW 1 195129831 missense probably damaging 0.97
R5977:Cr1l UTSW 1 195114768 nonsense probably null
R6113:Cr1l UTSW 1 195131411 unclassified probably benign
R6424:Cr1l UTSW 1 195117815 missense probably damaging 1.00
R7082:Cr1l UTSW 1 195123698 missense probably benign 0.36
R7174:Cr1l UTSW 1 195129189 missense probably benign 0.00
R7199:Cr1l UTSW 1 195117570 missense probably benign 0.20
R7979:Cr1l UTSW 1 195117722 missense probably damaging 1.00
R8104:Cr1l UTSW 1 195117617 missense possibly damaging 0.80
X0020:Cr1l UTSW 1 195129853 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTGTTTGAGGCACGGTA -3'
(R):5'- TTCTGGTGGCCCCATAACT -3'

Sequencing Primer
(F):5'- GCACGGTATATTATTCTGTGACTCAG -3'
(R):5'- CTGGTGGCCCCATAACTAATAATG -3'
Posted On2018-04-02