Incidental Mutation 'R6324:Baz2b'
ID 510637
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Name bromodomain adjacent to zinc finger domain, 2B
Synonyms D2Ertd794e, 5830435C13Rik
MMRRC Submission 044478-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.287) question?
Stock # R6324 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 59729707-60040183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59737292 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1877 (S1877P)
Ref Sequence ENSEMBL: ENSMUSP00000108169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
AlphaFold A2AUY4
Predicted Effect probably damaging
Transcript: ENSMUST00000090925
AA Change: S1877P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: S1877P

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112550
AA Change: S1877P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: S1877P

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130637
AA Change: S202P
SMART Domains Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987
AA Change: S202P

DomainStartEndE-ValueType
Pfam:WHIM3 2 37 1.8e-13 PFAM
low complexity region 162 173 N/A INTRINSIC
PHD 214 253 2.05e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G A 1: 34,762,558 (GRCm39) A605T unknown Het
Atp13a3 A G 16: 30,151,103 (GRCm39) V1069A possibly damaging Het
Atp1a2 C G 1: 172,116,903 (GRCm39) R238P probably damaging Het
Ccdc27 A T 4: 154,120,648 (GRCm39) S383T probably benign Het
Cr1l A G 1: 194,793,430 (GRCm39) V377A probably benign Het
Dazap1 A G 10: 80,113,494 (GRCm39) E130G probably benign Het
Dchs1 G T 7: 105,414,145 (GRCm39) A890E probably benign Het
Dock10 G A 1: 80,482,893 (GRCm39) T2143I probably benign Het
Eif3j1 A G 2: 121,871,659 (GRCm39) D60G probably benign Het
Enah A G 1: 181,746,136 (GRCm39) S382P probably damaging Het
Fam171b A T 2: 83,709,608 (GRCm39) K427* probably null Het
Fmn2 A T 1: 174,440,119 (GRCm39) I1179L possibly damaging Het
Focad C T 4: 88,319,305 (GRCm39) R1505* probably null Het
Frem1 T C 4: 82,901,574 (GRCm39) T985A probably benign Het
Gm3404 A T 5: 146,464,917 (GRCm39) Q219L possibly damaging Het
Gm5592 A C 7: 40,935,959 (GRCm39) S154R probably damaging Het
Gpn3 C T 5: 122,510,638 (GRCm39) probably benign Het
Gpr158 A G 2: 21,815,365 (GRCm39) E586G probably damaging Het
Gstp2 A T 19: 4,090,499 (GRCm39) I162N probably benign Het
Lin7a T A 10: 107,216,076 (GRCm39) probably null Het
Loxl4 G A 19: 42,583,817 (GRCm39) L745F probably benign Het
Ms4a19 T A 19: 11,140,811 (GRCm39) M3L probably benign Het
Mybpc1 A G 10: 88,404,481 (GRCm39) I172T possibly damaging Het
Nalcn A G 14: 123,647,161 (GRCm39) W571R possibly damaging Het
Nkx2-5 G C 17: 27,060,095 (GRCm39) P79A probably benign Het
Nufip2 A G 11: 77,582,487 (GRCm39) T134A probably benign Het
Odad1 A G 7: 45,591,134 (GRCm39) E203G probably damaging Het
Or13p4 G A 4: 118,547,728 (GRCm39) probably benign Het
Or5al1 C T 2: 85,989,800 (GRCm39) V305I probably benign Het
Or5b109 A G 19: 13,212,468 (GRCm39) M285V possibly damaging Het
Phkb A G 8: 86,745,171 (GRCm39) D616G probably benign Het
Plch1 C T 3: 63,688,811 (GRCm39) W131* probably null Het
Prl7b1 A T 13: 27,786,878 (GRCm39) probably null Het
Prop1 G A 11: 50,843,026 (GRCm39) P54S probably benign Het
Ptcd3 C T 6: 71,862,311 (GRCm39) V509I probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rapgef2 C T 3: 78,986,439 (GRCm39) V1182I probably benign Het
Rfx7 C A 9: 72,525,696 (GRCm39) P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Homo
Slc38a9 A G 13: 112,862,634 (GRCm39) I444M probably benign Het
Sorbs1 T C 19: 40,310,263 (GRCm39) T492A probably damaging Het
Synj1 A T 16: 90,735,518 (GRCm39) S1478R probably benign Het
Tnn T A 1: 159,972,774 (GRCm39) N276I probably damaging Het
Trbv19 G A 6: 41,155,692 (GRCm39) G21D probably damaging Het
Ube2o A T 11: 116,430,185 (GRCm39) D1184E probably benign Het
Vmn1r181 G A 7: 23,684,183 (GRCm39) R216Q probably benign Het
Vmn2r108 A T 17: 20,691,977 (GRCm39) L182* probably null Het
Vmn2r15 A G 5: 109,434,137 (GRCm39) *856R probably null Het
Vmn2r70 G A 7: 85,208,087 (GRCm39) H797Y probably benign Het
Zfp11 C T 5: 129,733,587 (GRCm39) A625T possibly damaging Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59,743,139 (GRCm39) missense probably benign 0.02
IGL00476:Baz2b APN 2 59,744,083 (GRCm39) missense probably benign 0.06
IGL00489:Baz2b APN 2 59,788,019 (GRCm39) nonsense probably null
IGL00514:Baz2b APN 2 59,792,821 (GRCm39) missense probably benign 0.11
IGL00678:Baz2b APN 2 59,836,527 (GRCm39) missense unknown
IGL01348:Baz2b APN 2 59,764,031 (GRCm39) missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59,799,233 (GRCm39) missense probably benign 0.18
IGL01924:Baz2b APN 2 59,765,615 (GRCm39) missense probably damaging 1.00
IGL02125:Baz2b APN 2 59,798,984 (GRCm39) missense probably benign 0.12
IGL02314:Baz2b APN 2 59,792,571 (GRCm39) missense probably benign
IGL02370:Baz2b APN 2 59,753,933 (GRCm39) missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59,790,407 (GRCm39) missense probably benign 0.40
IGL02499:Baz2b APN 2 59,731,840 (GRCm39) missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59,747,713 (GRCm39) missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59,778,604 (GRCm39) missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59,747,849 (GRCm39) unclassified probably benign
IGL02716:Baz2b APN 2 59,792,868 (GRCm39) missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59,807,718 (GRCm39) missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59,799,002 (GRCm39) missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59,807,872 (GRCm39) missense probably benign 0.00
IGL02886:Baz2b APN 2 59,788,087 (GRCm39) splice site probably null
IGL02892:Baz2b APN 2 59,731,080 (GRCm39) missense probably damaging 1.00
IGL03132:Baz2b APN 2 59,738,097 (GRCm39) splice site probably benign
IGL03183:Baz2b APN 2 59,733,640 (GRCm39) missense probably benign 0.10
IGL03197:Baz2b APN 2 59,731,898 (GRCm39) missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0122:Baz2b UTSW 2 59,743,963 (GRCm39) splice site probably null
R0136:Baz2b UTSW 2 59,732,298 (GRCm39) missense probably benign 0.22
R0144:Baz2b UTSW 2 59,737,839 (GRCm39) missense probably damaging 0.98
R0403:Baz2b UTSW 2 59,799,721 (GRCm39) missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59,732,340 (GRCm39) unclassified probably benign
R0528:Baz2b UTSW 2 59,767,083 (GRCm39) missense probably damaging 1.00
R1025:Baz2b UTSW 2 59,792,826 (GRCm39) missense probably benign 0.06
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59,752,553 (GRCm39) missense probably damaging 1.00
R1511:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R1514:Baz2b UTSW 2 59,792,670 (GRCm39) missense probably benign 0.13
R1519:Baz2b UTSW 2 59,778,598 (GRCm39) missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59,798,981 (GRCm39) missense possibly damaging 0.47
R1630:Baz2b UTSW 2 59,836,474 (GRCm39) missense unknown
R1641:Baz2b UTSW 2 59,743,234 (GRCm39) missense probably damaging 0.99
R1674:Baz2b UTSW 2 59,743,336 (GRCm39) missense possibly damaging 0.53
R1778:Baz2b UTSW 2 59,836,480 (GRCm39) missense unknown
R1826:Baz2b UTSW 2 59,799,077 (GRCm39) missense probably benign 0.12
R1835:Baz2b UTSW 2 59,732,163 (GRCm39) missense probably benign 0.02
R1954:Baz2b UTSW 2 59,799,087 (GRCm39) missense probably benign 0.12
R1981:Baz2b UTSW 2 59,754,024 (GRCm39) missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59,743,067 (GRCm39) unclassified probably benign
R2567:Baz2b UTSW 2 59,744,255 (GRCm39) missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59,743,348 (GRCm39) missense probably benign 0.27
R2848:Baz2b UTSW 2 59,755,010 (GRCm39) missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59,799,240 (GRCm39) missense probably benign 0.12
R3935:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59,742,917 (GRCm39) splice site probably null
R4182:Baz2b UTSW 2 59,928,801 (GRCm39) intron probably benign
R4255:Baz2b UTSW 2 59,750,916 (GRCm39) unclassified probably benign
R4359:Baz2b UTSW 2 59,731,957 (GRCm39) missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59,799,599 (GRCm39) missense probably benign 0.06
R4743:Baz2b UTSW 2 59,744,255 (GRCm39) missense probably benign 0.01
R4772:Baz2b UTSW 2 59,788,795 (GRCm39) missense probably damaging 0.96
R4858:Baz2b UTSW 2 59,738,087 (GRCm39) missense probably benign
R4868:Baz2b UTSW 2 59,755,226 (GRCm39) missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59,773,103 (GRCm39) splice site probably null
R4889:Baz2b UTSW 2 59,767,070 (GRCm39) missense probably damaging 1.00
R4890:Baz2b UTSW 2 59,756,383 (GRCm39) missense probably damaging 0.99
R4914:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R5027:Baz2b UTSW 2 59,928,988 (GRCm39) intron probably benign
R5031:Baz2b UTSW 2 59,743,151 (GRCm39) missense probably benign 0.00
R5082:Baz2b UTSW 2 59,731,835 (GRCm39) nonsense probably null
R5133:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R5276:Baz2b UTSW 2 59,792,958 (GRCm39) missense probably benign 0.40
R5279:Baz2b UTSW 2 59,762,496 (GRCm39) missense probably damaging 1.00
R5294:Baz2b UTSW 2 59,808,946 (GRCm39) missense probably benign 0.11
R5447:Baz2b UTSW 2 59,744,332 (GRCm39) missense probably damaging 0.99
R5903:Baz2b UTSW 2 59,790,233 (GRCm39) missense probably damaging 0.99
R5910:Baz2b UTSW 2 59,807,770 (GRCm39) missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59,742,871 (GRCm39) missense probably damaging 0.99
R6195:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59,809,019 (GRCm39) missense probably benign 0.00
R6208:Baz2b UTSW 2 59,755,150 (GRCm39) missense probably damaging 1.00
R6233:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59,778,567 (GRCm39) missense probably damaging 1.00
R6490:Baz2b UTSW 2 59,732,073 (GRCm39) missense probably damaging 1.00
R6578:Baz2b UTSW 2 59,799,623 (GRCm39) missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59,755,234 (GRCm39) missense probably damaging 1.00
R6760:Baz2b UTSW 2 59,792,776 (GRCm39) missense probably benign 0.40
R6836:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R6859:Baz2b UTSW 2 59,731,874 (GRCm39) missense probably benign 0.01
R6880:Baz2b UTSW 2 59,743,283 (GRCm39) missense probably damaging 0.99
R6916:Baz2b UTSW 2 59,799,120 (GRCm39) missense probably benign
R6978:Baz2b UTSW 2 59,738,059 (GRCm39) missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59,764,014 (GRCm39) critical splice donor site probably null
R7112:Baz2b UTSW 2 59,792,528 (GRCm39) missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59,742,841 (GRCm39) missense
R7198:Baz2b UTSW 2 59,792,550 (GRCm39) missense probably benign 0.00
R7270:Baz2b UTSW 2 59,792,836 (GRCm39) missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59,750,781 (GRCm39) missense probably benign 0.17
R7464:Baz2b UTSW 2 59,807,792 (GRCm39) missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59,792,817 (GRCm39) missense probably benign 0.40
R7703:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R7850:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7851:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7988:Baz2b UTSW 2 59,792,485 (GRCm39) missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59,731,112 (GRCm39) missense probably damaging 1.00
R8084:Baz2b UTSW 2 59,792,580 (GRCm39) missense probably benign
R8343:Baz2b UTSW 2 59,731,858 (GRCm39) missense probably damaging 1.00
R8348:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8438:Baz2b UTSW 2 59,747,828 (GRCm39) nonsense probably null
R8448:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8511:Baz2b UTSW 2 59,732,158 (GRCm39) missense probably benign
R8893:Baz2b UTSW 2 59,755,149 (GRCm39) missense probably damaging 0.96
R8947:Baz2b UTSW 2 59,778,583 (GRCm39) missense probably benign 0.06
R8998:Baz2b UTSW 2 59,799,608 (GRCm39) missense probably benign 0.02
R9241:Baz2b UTSW 2 59,743,993 (GRCm39) missense probably benign 0.01
R9245:Baz2b UTSW 2 59,743,331 (GRCm39) missense probably benign
R9577:Baz2b UTSW 2 59,809,031 (GRCm39) missense probably benign 0.06
R9581:Baz2b UTSW 2 59,799,300 (GRCm39) missense probably benign
R9601:Baz2b UTSW 2 59,731,847 (GRCm39) missense possibly damaging 0.66
R9613:Baz2b UTSW 2 59,731,824 (GRCm39) missense probably benign 0.09
R9639:Baz2b UTSW 2 59,731,828 (GRCm39) missense probably benign 0.01
X0011:Baz2b UTSW 2 59,807,705 (GRCm39) missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59,731,019 (GRCm39) missense probably damaging 1.00
X0064:Baz2b UTSW 2 59,799,626 (GRCm39) missense probably benign
Z1088:Baz2b UTSW 2 59,790,359 (GRCm39) missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59,807,864 (GRCm39) missense probably benign 0.01
Z1188:Baz2b UTSW 2 59,807,749 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTACGAGAAGCTCAAGGTG -3'
(R):5'- GCCAGTCTGTGCACTACATC -3'

Sequencing Primer
(F):5'- GGTGAGGGAAAAGTAAGATTATATGC -3'
(R):5'- CAGTCTGTGCACTACATCAGATTTAG -3'
Posted On 2018-04-02