Incidental Mutation 'R6324:Olfr1042'
ID510639
Institutional Source Beutler Lab
Gene Symbol Olfr1042
Ensembl Gene ENSMUSG00000075202
Gene Nameolfactory receptor 1042
SynonymsMOR185-10, GA_x6K02T2Q125-47629317-47628376
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6324 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86156743-86161838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86159456 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 305 (V305I)
Ref Sequence ENSEMBL: ENSMUSP00000151053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099907] [ENSMUST00000099908] [ENSMUST00000213886] [ENSMUST00000213949] [ENSMUST00000215624] [ENSMUST00000216028]
Predicted Effect probably benign
Transcript: ENSMUST00000099907
SMART Domains Protein: ENSMUSP00000097491
Gene: ENSMUSG00000075201

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.9e-46 PFAM
Pfam:7tm_1 41 290 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099908
AA Change: V305I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097492
Gene: ENSMUSG00000075202
AA Change: V305I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.2e-48 PFAM
Pfam:7tm_1 41 290 1.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213886
Predicted Effect probably benign
Transcript: ENSMUST00000213949
Predicted Effect probably benign
Transcript: ENSMUST00000215624
AA Change: V305I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216028
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Olfr1042
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01914:Olfr1042 APN 2 86160047 missense probably benign 0.04
IGL02071:Olfr1042 APN 2 86159875 missense probably benign
IGL02935:Olfr1042 APN 2 86160370 unclassified probably benign
IGL03152:Olfr1042 APN 2 86159686 missense possibly damaging 0.95
R0089:Olfr1042 UTSW 2 86159574 missense possibly damaging 0.89
R1419:Olfr1042 UTSW 2 86159429 makesense probably null
R1699:Olfr1042 UTSW 2 86159936 missense probably benign
R1804:Olfr1042 UTSW 2 86160073 missense probably benign 0.38
R3162:Olfr1042 UTSW 2 86160095 missense probably benign 0.03
R3162:Olfr1042 UTSW 2 86160095 missense probably benign 0.03
R3609:Olfr1042 UTSW 2 86159632 missense probably benign 0.00
R3953:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3955:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3956:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3957:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R4771:Olfr1042 UTSW 2 86160073 missense probably benign 0.38
R5685:Olfr1042 UTSW 2 86159795 missense probably damaging 0.99
R6241:Olfr1042 UTSW 2 86160036 missense probably damaging 1.00
R6678:Olfr1042 UTSW 2 86160185 missense probably damaging 0.98
R6921:Olfr1042 UTSW 2 86159852 missense probably benign 0.02
R7215:Olfr1042 UTSW 2 86159456 missense probably benign
R7386:Olfr1042 UTSW 2 86159530 missense possibly damaging 0.83
R8030:Olfr1042 UTSW 2 86160242 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCATTCAGTTTCACAGAGCC -3'
(R):5'- ACTTGTGCATCCCACCTGAC -3'

Sequencing Primer
(F):5'- TCCATTTCATTTGAAGTTACTGGG -3'
(R):5'- CCTGACTTCCATCACCATATTTTATG -3'
Posted On2018-04-02