Incidental Mutation 'R6324:Ptcd3'
ID510652
Institutional Source Beutler Lab
Gene Symbol Ptcd3
Ensembl Gene ENSMUSG00000063884
Gene Namepentatricopeptide repeat domain 3
Synonyms2610034F17Rik, 2810422B04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6324 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location71880638-71908750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71885327 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 509 (V509I)
Ref Sequence ENSEMBL: ENSMUSP00000080743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082094] [ENSMUST00000206879]
Predicted Effect probably benign
Transcript: ENSMUST00000082094
AA Change: V509I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080743
Gene: ENSMUSG00000063884
AA Change: V509I

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 216 227 N/A INTRINSIC
Pfam:PPR_2 253 300 1.4e-10 PFAM
Pfam:PPR_3 331 366 2.1e-4 PFAM
low complexity region 671 684 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205269
Predicted Effect probably benign
Transcript: ENSMUST00000205556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206762
Predicted Effect probably benign
Transcript: ENSMUST00000206879
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Ptcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Ptcd3 APN 6 71903448 missense probably damaging 0.96
IGL00903:Ptcd3 APN 6 71907844 missense possibly damaging 0.93
IGL01545:Ptcd3 APN 6 71888577 missense probably benign 0.01
IGL01924:Ptcd3 APN 6 71898427 missense probably damaging 1.00
IGL02675:Ptcd3 APN 6 71883442 critical splice donor site probably null
R0732:Ptcd3 UTSW 6 71881171 unclassified probably benign
R1374:Ptcd3 UTSW 6 71908653 nonsense probably null
R1393:Ptcd3 UTSW 6 71889621 missense probably benign 0.00
R1498:Ptcd3 UTSW 6 71893495 missense probably damaging 1.00
R1646:Ptcd3 UTSW 6 71898395 missense probably benign 0.26
R1712:Ptcd3 UTSW 6 71908653 nonsense probably null
R2022:Ptcd3 UTSW 6 71885553 missense probably damaging 1.00
R2248:Ptcd3 UTSW 6 71894285 critical splice donor site probably null
R2406:Ptcd3 UTSW 6 71888647 missense probably damaging 1.00
R3418:Ptcd3 UTSW 6 71883486 missense possibly damaging 0.93
R3419:Ptcd3 UTSW 6 71883486 missense possibly damaging 0.93
R4677:Ptcd3 UTSW 6 71893514 missense probably benign 0.17
R4741:Ptcd3 UTSW 6 71902949 missense probably damaging 1.00
R4752:Ptcd3 UTSW 6 71901312 missense probably damaging 0.99
R5441:Ptcd3 UTSW 6 71881521 missense possibly damaging 0.62
R5583:Ptcd3 UTSW 6 71902936 missense probably damaging 1.00
R5681:Ptcd3 UTSW 6 71907659 missense probably damaging 1.00
R6028:Ptcd3 UTSW 6 71898408 missense probably damaging 1.00
R6537:Ptcd3 UTSW 6 71897110 splice site probably null
R6600:Ptcd3 UTSW 6 71883546 missense probably damaging 1.00
R6783:Ptcd3 UTSW 6 71908643 missense probably benign 0.00
R6810:Ptcd3 UTSW 6 71885532 missense probably damaging 0.99
R6860:Ptcd3 UTSW 6 71897110 splice site probably null
R6993:Ptcd3 UTSW 6 71885315 missense probably damaging 1.00
R7578:Ptcd3 UTSW 6 71908707 missense probably benign
R7788:Ptcd3 UTSW 6 71885557 missense probably benign 0.00
R7851:Ptcd3 UTSW 6 71902859 missense probably damaging 1.00
R7888:Ptcd3 UTSW 6 71883447 missense probably damaging 1.00
R7889:Ptcd3 UTSW 6 71888608 missense probably damaging 1.00
R7919:Ptcd3 UTSW 6 71903454 missense probably damaging 1.00
R8162:Ptcd3 UTSW 6 71907814 missense probably benign 0.02
R8351:Ptcd3 UTSW 6 71908641 missense probably benign 0.00
R8451:Ptcd3 UTSW 6 71908641 missense probably benign 0.00
X0024:Ptcd3 UTSW 6 71901274 missense probably damaging 1.00
X0065:Ptcd3 UTSW 6 71907806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCTCTGTTAAGAATGGAGGC -3'
(R):5'- TGAAGTGGTATAAGGACCTAATACC -3'

Sequencing Primer
(F):5'- TGAAGGTCCTGAGTTGAAATCCC -3'
(R):5'- GTGGTATAAGGACCTAATACCTTCAG -3'
Posted On2018-04-02