Incidental Mutation 'R6324:Vmn1r181'
ID510653
Institutional Source Beutler Lab
Gene Symbol Vmn1r181
Ensembl Gene ENSMUSG00000097425
Gene Namevomeronasal 1 receptor 181
SynonymsV1rd20
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6324 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location23974615-23988139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23984758 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 216 (R216Q)
Ref Sequence ENSEMBL: ENSMUSP00000154403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181796] [ENSMUST00000226843] [ENSMUST00000226978] [ENSMUST00000227637] [ENSMUST00000228399] [ENSMUST00000228842]
Predicted Effect probably benign
Transcript: ENSMUST00000181796
AA Change: R216Q

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137685
Gene: ENSMUSG00000097425
AA Change: R216Q

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 3.9e-9 PFAM
Pfam:V1R 41 295 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226843
AA Change: R216Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000226978
AA Change: R216Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227637
AA Change: R216Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000228399
AA Change: R216Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228607
Predicted Effect probably benign
Transcript: ENSMUST00000228842
AA Change: R216Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Vmn1r181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Vmn1r181 APN 7 23984581 missense possibly damaging 0.91
IGL02055:Vmn1r181 APN 7 23984553 missense probably damaging 1.00
IGL02444:Vmn1r181 APN 7 23984523 missense probably damaging 1.00
IGL03012:Vmn1r181 APN 7 23984602 missense probably damaging 0.98
IGL03026:Vmn1r181 APN 7 23984575 missense possibly damaging 0.94
R0255:Vmn1r181 UTSW 7 23984334 missense probably benign 0.02
R1481:Vmn1r181 UTSW 7 23984712 missense probably damaging 1.00
R2847:Vmn1r181 UTSW 7 23984518 missense possibly damaging 0.88
R2848:Vmn1r181 UTSW 7 23984518 missense possibly damaging 0.88
R2849:Vmn1r181 UTSW 7 23984518 missense possibly damaging 0.88
R3441:Vmn1r181 UTSW 7 23984883 missense probably benign 0.05
R3757:Vmn1r181 UTSW 7 23984484 missense possibly damaging 0.90
R3945:Vmn1r181 UTSW 7 23984152 missense probably damaging 0.98
R3983:Vmn1r181 UTSW 7 23984809 missense probably benign 0.23
R4780:Vmn1r181 UTSW 7 23984583 missense possibly damaging 0.64
R4999:Vmn1r181 UTSW 7 23984365 missense probably damaging 0.99
R5463:Vmn1r181 UTSW 7 23984362 missense probably benign 0.02
R5672:Vmn1r181 UTSW 7 23984316 missense probably damaging 1.00
R6229:Vmn1r181 UTSW 7 23984155 missense probably damaging 1.00
R6315:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6316:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6317:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6326:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6988:Vmn1r181 UTSW 7 23984847 missense probably damaging 1.00
R7446:Vmn1r181 UTSW 7 23984931 missense probably benign 0.01
R7972:Vmn1r181 UTSW 7 23984446 missense probably benign 0.30
R8465:Vmn1r181 UTSW 7 23984884 missense possibly damaging 0.65
X0067:Vmn1r181 UTSW 7 23984901 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAAGTGTCCCGAATTTGGTG -3'
(R):5'- TGCCTCAGGAATTGGTGAG -3'

Sequencing Primer
(F):5'- ATTCCAATTAAGGTCACTGGTCCAC -3'
(R):5'- TGTGACTACCAGCATCAG -3'
Posted On2018-04-02