Incidental Mutation 'R6324:Gm5592'
ID510654
Institutional Source Beutler Lab
Gene Symbol Gm5592
Ensembl Gene ENSMUSG00000072259
Gene Namepredicted gene 5592
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6324 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location41153841-41290183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 41286535 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 154 (S154R)
Ref Sequence ENSEMBL: ENSMUSP00000145899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097044] [ENSMUST00000206490]
Predicted Effect probably damaging
Transcript: ENSMUST00000097044
AA Change: S154R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094809
Gene: ENSMUSG00000072259
AA Change: S154R

DomainStartEndE-ValueType
Pfam:DUF4629 435 580 6.1e-60 PFAM
low complexity region 607 612 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206040
Predicted Effect probably damaging
Transcript: ENSMUST00000206490
AA Change: S154R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Gm5592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Gm5592 APN 7 41289095 missense probably damaging 1.00
IGL01472:Gm5592 APN 7 41286074 splice site probably benign
IGL01718:Gm5592 APN 7 41289193 missense probably damaging 0.99
IGL01981:Gm5592 APN 7 41286371 nonsense probably null
IGL02318:Gm5592 APN 7 41286788 missense probably benign 0.37
IGL02346:Gm5592 APN 7 41289465 missense probably damaging 0.97
IGL02904:Gm5592 APN 7 41288386 missense probably damaging 1.00
I1329:Gm5592 UTSW 7 41286354 nonsense probably null
R0465:Gm5592 UTSW 7 41156057 intron probably benign
R0669:Gm5592 UTSW 7 41155830 intron probably benign
R0675:Gm5592 UTSW 7 41289387 missense possibly damaging 0.81
R1381:Gm5592 UTSW 7 41286172 missense probably benign
R1731:Gm5592 UTSW 7 41288413 missense probably damaging 0.99
R3149:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3150:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3176:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3177:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3276:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3277:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3623:Gm5592 UTSW 7 41157628 intron probably benign
R3797:Gm5592 UTSW 7 41157835 intron probably benign
R3854:Gm5592 UTSW 7 41157835 intron probably benign
R3856:Gm5592 UTSW 7 41157835 intron probably benign
R4009:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4010:Gm5592 UTSW 7 41286628 missense probably benign 0.05
R4011:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4127:Gm5592 UTSW 7 41289067 missense probably benign 0.00
R4162:Gm5592 UTSW 7 41217778 intron probably benign
R4289:Gm5592 UTSW 7 41158912 intron probably benign
R4304:Gm5592 UTSW 7 41286262 missense probably benign 0.20
R4332:Gm5592 UTSW 7 41216118 intron probably benign
R4408:Gm5592 UTSW 7 41286448 missense probably benign 0.04
R4572:Gm5592 UTSW 7 41216159 intron probably benign
R4764:Gm5592 UTSW 7 41216118 intron probably benign
R4822:Gm5592 UTSW 7 41155890 intron probably benign
R4836:Gm5592 UTSW 7 41215534 intron probably benign
R4854:Gm5592 UTSW 7 41217471 intron probably benign
R5032:Gm5592 UTSW 7 41289735 missense probably damaging 1.00
R5075:Gm5592 UTSW 7 41158963 intron probably benign
R5369:Gm5592 UTSW 7 41218211 intron probably benign
R5424:Gm5592 UTSW 7 41155593 intron probably benign
R5700:Gm5592 UTSW 7 41158579 intron probably benign
R5741:Gm5592 UTSW 7 41289201 missense probably benign
R5802:Gm5592 UTSW 7 41219105 intron probably benign
R5945:Gm5592 UTSW 7 41215612 intron probably benign
R6117:Gm5592 UTSW 7 41288464 missense probably benign 0.00
R6449:Gm5592 UTSW 7 41288586 missense probably benign 0.09
R6571:Gm5592 UTSW 7 41288575 missense probably damaging 0.98
R6776:Gm5592 UTSW 7 41289729 missense probably damaging 1.00
R7595:Gm5592 UTSW 7 41286443 missense probably damaging 0.99
R7658:Gm5592 UTSW 7 41288710 missense probably benign 0.03
R7699:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7700:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7774:Gm5592 UTSW 7 41289859 missense probably damaging 1.00
R7788:Gm5592 UTSW 7 41286694 missense probably benign 0.01
R7890:Gm5592 UTSW 7 41286759 missense probably damaging 1.00
R8070:Gm5592 UTSW 7 41286463 missense possibly damaging 0.76
R8417:Gm5592 UTSW 7 41288551 missense probably benign 0.38
X0021:Gm5592 UTSW 7 41288508 missense probably benign 0.01
Z1176:Gm5592 UTSW 7 41286317 missense probably damaging 1.00
Z1176:Gm5592 UTSW 7 41286319 missense possibly damaging 0.94
Z1176:Gm5592 UTSW 7 41288681 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTCAAGTGGGATTGCACTGG -3'
(R):5'- GGCTGAATCTCCTTTAGCACC -3'

Sequencing Primer
(F):5'- TTGCACTGGAAGCACTCATG -3'
(R):5'- CATCTCTGGTTGGAGCACAGAG -3'
Posted On2018-04-02