Incidental Mutation 'R6324:Ccdc114'
ID510655
Institutional Source Beutler Lab
Gene Symbol Ccdc114
Ensembl Gene ENSMUSG00000040189
Gene Namecoiled-coil domain containing 114
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6324 (G1)
Quality Score124.008
Status Validated
Chromosome7
Chromosomal Location45924072-45948963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45941710 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 203 (E203G)
Ref Sequence ENSEMBL: ENSMUSP00000042772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038720] [ENSMUST00000210867]
Predicted Effect probably damaging
Transcript: ENSMUST00000038720
AA Change: E203G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042772
Gene: ENSMUSG00000040189
AA Change: E203G

DomainStartEndE-ValueType
coiled coil region 11 94 N/A INTRINSIC
coiled coil region 137 156 N/A INTRINSIC
low complexity region 174 185 N/A INTRINSIC
coiled coil region 195 229 N/A INTRINSIC
coiled coil region 303 380 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
low complexity region 558 588 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 621 656 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000210867
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that is a component of the outer dynein arm docking complex in cilia cells. Mutations in this gene may cause primary ciliary dyskinesia 20. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Ccdc114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Ccdc114 APN 7 45942656 missense probably damaging 1.00
IGL01383:Ccdc114 APN 7 45939700 missense probably damaging 1.00
IGL01826:Ccdc114 APN 7 45948386 missense possibly damaging 0.62
R0865:Ccdc114 UTSW 7 45942088 missense probably benign 0.17
R1061:Ccdc114 UTSW 7 45941755 missense probably damaging 0.96
R1217:Ccdc114 UTSW 7 45942758 splice site probably benign
R1533:Ccdc114 UTSW 7 45942858 missense probably benign 0.00
R2863:Ccdc114 UTSW 7 45948312 missense probably benign 0.04
R3954:Ccdc114 UTSW 7 45941676 missense probably damaging 1.00
R4774:Ccdc114 UTSW 7 45948380 missense probably damaging 0.99
R4861:Ccdc114 UTSW 7 45942873 missense probably damaging 0.98
R4861:Ccdc114 UTSW 7 45942873 missense probably damaging 0.98
R4952:Ccdc114 UTSW 7 45942191 missense probably damaging 1.00
R5074:Ccdc114 UTSW 7 45929090 missense probably benign 0.05
R5187:Ccdc114 UTSW 7 45929116 missense probably damaging 1.00
R5265:Ccdc114 UTSW 7 45947435 missense probably damaging 1.00
R5364:Ccdc114 UTSW 7 45936332 missense probably damaging 0.99
R5377:Ccdc114 UTSW 7 45942082 nonsense probably null
R6221:Ccdc114 UTSW 7 45947479 missense probably damaging 1.00
R6246:Ccdc114 UTSW 7 45936364 missense probably damaging 1.00
R6389:Ccdc114 UTSW 7 45948516 missense probably benign 0.32
R6542:Ccdc114 UTSW 7 45948390 missense probably benign 0.00
R6593:Ccdc114 UTSW 7 45947384 missense probably damaging 0.96
R7215:Ccdc114 UTSW 7 45936622 missense probably damaging 1.00
R7401:Ccdc114 UTSW 7 45942765 missense probably damaging 1.00
R7431:Ccdc114 UTSW 7 45929246 missense probably damaging 0.99
R7725:Ccdc114 UTSW 7 45948411 missense probably damaging 0.98
R7878:Ccdc114 UTSW 7 45924560 missense possibly damaging 0.91
R8036:Ccdc114 UTSW 7 45942852 missense probably benign 0.06
X0064:Ccdc114 UTSW 7 45948393 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGTGAGCATCCTTGGGAAGC -3'
(R):5'- CTTCTCCTAAGGGGCTTCAC -3'

Sequencing Primer
(F):5'- ATCCTTGGGAAGCCACCTG -3'
(R):5'- ATGATGATAGCTGTAGTGGCCC -3'
Posted On2018-04-02