Mutagenetix > Incidental Mutations

Incidental Mutation 'R6324:Mybpc1'

510662

Institutional Source

Beutler Lab

Gene Symbol

Mybpc1

Ensembl Gene

ENSMUSG00000020061

Gene Name

myosin binding protein C, slow-type

Synonyms

8030451F13Rik, Slow-type C-protein

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R6324 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88518279-88605152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88568619 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 172 (I172T)

Ref Sequence

ENSEMBL: ENSMUSP00000112615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119185
AA Change: I158T

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: I158T

Domain	Start	End	E-Value	Type
IG	51	147	1.96e-6	SMART
low complexity region	221	233	N/A	INTRINSIC
IG	246	325	4.53e-2	SMART
IG	335	416	1.13e-2	SMART
IG	426	506	6.97e-3	SMART
IG	519	604	2.83e-3	SMART
FN3	607	690	4.28e-10	SMART
FN3	705	788	1.49e-9	SMART
low complexity region	800	812	N/A	INTRINSIC
IG	815	898	9.06e-2	SMART
FN3	901	983	2.06e-12	SMART
IGc2	1028	1095	1.88e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121629
AA Change: I172T

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: I172T

Domain	Start	End	E-Value	Type
low complexity region	8	27	N/A	INTRINSIC
IG	65	161	1.96e-6	SMART
low complexity region	235	247	N/A	INTRINSIC
IG	260	339	4.53e-2	SMART
IG	349	430	1.13e-2	SMART
IG	440	520	6.97e-3	SMART
IG	533	618	2.83e-3	SMART
FN3	621	704	4.28e-10	SMART
FN3	719	802	1.49e-9	SMART
low complexity region	814	826	N/A	INTRINSIC
IG	829	912	9.06e-2	SMART
FN3	915	997	2.06e-12	SMART
IGc2	1042	1109	1.88e-8	SMART

Meta Mutation Damage Score

0.2846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025F22Rik	T	A	19: 11,163,447	M3L	probably benign	Het
Arhgef4	G	A	1: 34,723,477	A605T	unknown	Het
Atp13a3	A	G	16: 30,332,285	V1069A	possibly damaging	Het
Atp1a2	C	G	1: 172,289,336	R238P	probably damaging	Het
Baz2b	A	G	2: 59,906,948	S1877P	probably damaging	Het
Ccdc114	A	G	7: 45,941,710	E203G	probably damaging	Het
Ccdc27	A	T	4: 154,036,191	S383T	probably benign	Het
Cr1l	A	G	1: 195,111,122	V377A	probably benign	Het
Dazap1	A	G	10: 80,277,660	E130G	probably benign	Het
Dchs1	G	T	7: 105,764,938	A890E	probably benign	Het
Dock10	G	A	1: 80,505,176	T2143I	probably benign	Het
Eif3j1	A	G	2: 122,041,178	D60G	probably benign	Het
Enah	A	G	1: 181,918,571	S382P	probably damaging	Het
Fam171b	A	T	2: 83,879,264	K427*	probably null	Het
Fmn2	A	T	1: 174,612,553	I1179L	possibly damaging	Het
Focad	C	T	4: 88,401,068	R1505*	probably null	Het
Frem1	T	C	4: 82,983,337	T985A	probably benign	Het
Gm3404	A	T	5: 146,528,107	Q219L	possibly damaging	Het
Gm5592	A	C	7: 41,286,535	S154R	probably damaging	Het
Gpn3	C	T	5: 122,372,575		probably benign	Het
Gpr158	A	G	2: 21,810,554	E586G	probably damaging	Het
Gstp2	A	T	19: 4,040,499	I162N	probably benign	Het
Lin7a	T	A	10: 107,380,215		probably null	Het
Loxl4	G	A	19: 42,595,378	L745F	probably benign	Het
Nalcn	A	G	14: 123,409,749	W571R	possibly damaging	Het
Nkx2-5	G	C	17: 26,841,121	P79A	probably benign	Het
Nufip2	A	G	11: 77,691,661	T134A	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1342	G	A	4: 118,690,531		probably benign	Het
Olfr1463	A	G	19: 13,235,104	M285V	possibly damaging	Het
Phkb	A	G	8: 86,018,542	D616G	probably benign	Het
Plch1	C	T	3: 63,781,390	W131*	probably null	Het
Prl7b1	A	T	13: 27,602,895		probably null	Het
Prop1	G	A	11: 50,952,199	P54S	probably benign	Het
Ptcd3	C	T	6: 71,885,327	V509I	probably benign	Het
Ptprg	T	A	14: 12,226,314	D527E	probably damaging	Het
Rapgef2	C	T	3: 79,079,132	V1182I	probably benign	Het
Rfx7	C	A	9: 72,618,414	P962Q	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Slc38a9	A	G	13: 112,726,100	I444M	probably benign	Het
Sorbs1	T	C	19: 40,321,819	T492A	probably damaging	Het
Synj1	A	T	16: 90,938,630	S1478R	probably benign	Het
Tnn	T	A	1: 160,145,204	N276I	probably damaging	Het
Trbv19	G	A	6: 41,178,758	G21D	probably damaging	Het
Ube2o	A	T	11: 116,539,359	D1184E	probably benign	Het
Vmn1r181	G	A	7: 23,984,758	R216Q	probably benign	Het
Vmn2r108	A	T	17: 20,471,715	L182*	probably null	Het
Vmn2r15	A	G	5: 109,286,271	*856R	probably null	Het
Vmn2r70	G	A	7: 85,558,879	H797Y	probably benign	Het
Zfp11	C	T	5: 129,656,523	A625T	possibly damaging	Het

Other mutations in Mybpc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Mybpc1	APN	10	88549262	missense	probably damaging	0.98
IGL00577:Mybpc1	APN	10	88536384	missense	probably damaging	1.00
IGL00703:Mybpc1	APN	10	88525108	splice site	probably null
IGL00964:Mybpc1	APN	10	88555742	critical splice acceptor site	probably null
IGL01738:Mybpc1	APN	10	88570645	missense	probably damaging	1.00
IGL01978:Mybpc1	APN	10	88531770	missense	probably damaging	1.00
IGL02255:Mybpc1	APN	10	88536428	missense	probably damaging	1.00
IGL02997:Mybpc1	APN	10	88526373	missense	probably damaging	1.00
R0098:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0449:Mybpc1	UTSW	10	88540960	missense	probably damaging	1.00
R0879:Mybpc1	UTSW	10	88571516	splice site	probably benign
R1321:Mybpc1	UTSW	10	88529541	missense	possibly damaging	0.85
R1321:Mybpc1	UTSW	10	88570601	missense	probably damaging	1.00
R1562:Mybpc1	UTSW	10	88553331	missense	probably damaging	1.00
R1783:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R1803:Mybpc1	UTSW	10	88553295	missense	possibly damaging	0.65
R1962:Mybpc1	UTSW	10	88548826	missense	probably damaging	1.00
R1972:Mybpc1	UTSW	10	88551542	missense	probably benign	0.00
R2006:Mybpc1	UTSW	10	88546059	missense	probably damaging	0.99
R2125:Mybpc1	UTSW	10	88573437	nonsense	probably null
R2129:Mybpc1	UTSW	10	88551452	missense	probably damaging	1.00
R2163:Mybpc1	UTSW	10	88540942	splice site	probably benign
R2200:Mybpc1	UTSW	10	88555695	missense	probably damaging	1.00
R2219:Mybpc1	UTSW	10	88555678	missense	probably damaging	1.00
R2270:Mybpc1	UTSW	10	88551407	missense	probably benign	0.01
R2961:Mybpc1	UTSW	10	88531779	missense	probably damaging	1.00
R3767:Mybpc1	UTSW	10	88570659	splice site	probably null
R4032:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R4226:Mybpc1	UTSW	10	88573525	nonsense	probably null
R4821:Mybpc1	UTSW	10	88548865	missense	probably damaging	0.98
R4876:Mybpc1	UTSW	10	88522991	missense	probably benign
R4876:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R4878:Mybpc1	UTSW	10	88551430	missense	possibly damaging	0.95
R4910:Mybpc1	UTSW	10	88555724	nonsense	probably null
R4913:Mybpc1	UTSW	10	88553254	critical splice donor site	probably null
R4964:Mybpc1	UTSW	10	88555663	missense	probably benign	0.31
R5023:Mybpc1	UTSW	10	88543774	missense	probably damaging	1.00
R5098:Mybpc1	UTSW	10	88546064	missense	probably damaging	1.00
R5196:Mybpc1	UTSW	10	88536351	missense	probably damaging	0.97
R5344:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R5399:Mybpc1	UTSW	10	88523014	missense	probably damaging	1.00
R5538:Mybpc1	UTSW	10	88546029	missense	possibly damaging	0.89
R5808:Mybpc1	UTSW	10	88570566	missense	possibly damaging	0.83
R5970:Mybpc1	UTSW	10	88542456	missense	probably damaging	1.00
R6433:Mybpc1	UTSW	10	88560355	missense	probably damaging	1.00
R6441:Mybpc1	UTSW	10	88553277	missense	probably benign	0.09
R6648:Mybpc1	UTSW	10	88522999	missense	probably damaging	0.96
R6844:Mybpc1	UTSW	10	88536381	missense	possibly damaging	0.50
R6931:Mybpc1	UTSW	10	88542330	nonsense	probably null
R6972:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6973:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6978:Mybpc1	UTSW	10	88523024	missense	probably damaging	1.00
R7007:Mybpc1	UTSW	10	88553412	missense	probably damaging	1.00
R7019:Mybpc1	UTSW	10	88543719	missense	probably damaging	1.00
R7407:Mybpc1	UTSW	10	88549347	missense	probably damaging	0.99
R7442:Mybpc1	UTSW	10	88526293	missense	probably damaging	1.00
R7577:Mybpc1	UTSW	10	88549325	missense	probably damaging	1.00
R7660:Mybpc1	UTSW	10	88548854	missense	possibly damaging	0.51
R7768:Mybpc1	UTSW	10	88542372	missense	probably damaging	1.00
R7818:Mybpc1	UTSW	10	88558667	missense	probably damaging	1.00
R8171:Mybpc1	UTSW	10	88523003	missense	probably damaging	1.00
R8195:Mybpc1	UTSW	10	88558691	missense	possibly damaging	0.47
R8241:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R8360:Mybpc1	UTSW	10	88573497	nonsense	probably null
Z1176:Mybpc1	UTSW	10	88560327	missense	probably benign
Z1177:Mybpc1	UTSW	10	88573437	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAACCAGGAGATCTGCAGAATG -3'
(R):5'- TGGCGATGTCCTGGTAACTC -3'

Sequencing Primer
(F):5'- GAGTTACCACTCTGACACGAATTC -3'
(R):5'- GATGTCCTGGTAACTCAGCCAC -3'

Posted On

2018-04-02