Incidental Mutation 'R6324:Prop1'
ID510663
Institutional Source Beutler Lab
Gene Symbol Prop1
Ensembl Gene ENSMUSG00000044542
Gene Namepaired like homeodomain factor 1
SynonymsProp-1, prophet of Pit1, prophet of Pit-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R6324 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location50950806-50953765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50952199 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 54 (P54S)
Ref Sequence ENSEMBL: ENSMUSP00000057231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051159] [ENSMUST00000162420]
Predicted Effect probably benign
Transcript: ENSMUST00000051159
AA Change: P54S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000057231
Gene: ENSMUSG00000044542
AA Change: P54S

DomainStartEndE-ValueType
HOX 66 128 4.85e-25 SMART
low complexity region 150 168 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159179
Predicted Effect probably benign
Transcript: ENSMUST00000162420
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a paired-like homeodomain transcription factor in the developing pituitary gland. Expression occurs prior to and is required for expression of pou domain transcription factor 1, which is responsible for pituitary development and hormone expression. Mutations in this gene have been associated with combined pituitary hormone deficiency-2 as well as deficiencies in luteinizing hormone, follicle-stimulating hormone, growth hormone, prolactin, and thyroid-stimulating hormone. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe proportional dwarfism, hypothyroidism, and sterility. Mutants fail to develop the anterior pituitary cells that secrete growth hormone, prolactin, and thyroid stimulating hormone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Prop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Prop1 APN 11 50952129 missense probably damaging 1.00
IGL02192:Prop1 APN 11 50953286 splice site probably benign
IGL02219:Prop1 APN 11 50952084 missense probably damaging 1.00
IGL02551:Prop1 APN 11 50950946 missense possibly damaging 0.83
R1642:Prop1 UTSW 11 50953325 missense possibly damaging 0.46
R4909:Prop1 UTSW 11 50952036 frame shift probably null
R4909:Prop1 UTSW 11 50952045 missense probably damaging 1.00
R5743:Prop1 UTSW 11 50951009 missense probably damaging 1.00
R5879:Prop1 UTSW 11 50953326 missense probably damaging 0.97
R6721:Prop1 UTSW 11 50953386 missense probably benign 0.27
R7162:Prop1 UTSW 11 50952054 missense probably damaging 0.99
RF005:Prop1 UTSW 11 50951130 missense possibly damaging 0.69
RF024:Prop1 UTSW 11 50951130 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GGGCATCATCACCTGGATTC -3'
(R):5'- GCAGGAGCTGTGATTTTGAAAG -3'

Sequencing Primer
(F):5'- ACCTGGATTCTGGCTTCACTGAG -3'
(R):5'- GAGCTGTGATTTTGAAAGCTGACAC -3'
Posted On2018-04-02