Incidental Mutation 'R6324:Ube2o'
ID510665
Institutional Source Beutler Lab
Gene Symbol Ube2o
Ensembl Gene ENSMUSG00000020802
Gene Nameubiquitin-conjugating enzyme E2O
SynonymsB230113M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.653) question?
Stock #R6324 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116537740-116581447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116539359 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1184 (D1184E)
Ref Sequence ENSEMBL: ENSMUSP00000080791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063396] [ENSMUST00000063446] [ENSMUST00000082152] [ENSMUST00000100201] [ENSMUST00000106386] [ENSMUST00000106387] [ENSMUST00000106388] [ENSMUST00000124682] [ENSMUST00000138840] [ENSMUST00000141798] [ENSMUST00000145737] [ENSMUST00000154034] [ENSMUST00000155102]
Predicted Effect probably benign
Transcript: ENSMUST00000063396
SMART Domains Protein: ENSMUSP00000064743
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063446
SMART Domains Protein: ENSMUSP00000067865
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082152
AA Change: D1184E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080791
Gene: ENSMUSG00000020802
AA Change: D1184E

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 470 505 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 705 712 N/A INTRINSIC
low complexity region 715 737 N/A INTRINSIC
coiled coil region 845 879 N/A INTRINSIC
UBCc 953 1110 2.23e-16 SMART
Blast:UBCc 1201 1274 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100201
SMART Domains Protein: ENSMUSP00000097775
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
low complexity region 256 262 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106386
SMART Domains Protein: ENSMUSP00000101994
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106387
SMART Domains Protein: ENSMUSP00000101995
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106388
SMART Domains Protein: ENSMUSP00000101996
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124682
SMART Domains Protein: ENSMUSP00000116055
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136526
Predicted Effect probably benign
Transcript: ENSMUST00000138840
SMART Domains Protein: ENSMUSP00000121064
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141798
SMART Domains Protein: ENSMUSP00000131010
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DAGKc 22 159 1.19e-8 SMART
low complexity region 263 269 N/A INTRINSIC
low complexity region 374 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148185
Predicted Effect probably benign
Transcript: ENSMUST00000145737
SMART Domains Protein: ENSMUSP00000114622
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150658
Predicted Effect probably benign
Transcript: ENSMUST00000154034
SMART Domains Protein: ENSMUSP00000121219
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155102
SMART Domains Protein: ENSMUSP00000114819
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
Pfam:DAGK_cat 16 116 4.6e-27 PFAM
Meta Mutation Damage Score 0.0575 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased MEF proliferation and transformation and increased pre-weaning lethality. Mice heterozygous for the allele exhibit increased total body fat amount, increased startle reflex, increased grip strength and increased circulating HDL cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Ube2o
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ube2o APN 11 116544754 missense probably benign
IGL00973:Ube2o APN 11 116541205 missense probably damaging 1.00
IGL01291:Ube2o APN 11 116540134 missense probably damaging 1.00
IGL01804:Ube2o APN 11 116544373 missense probably benign 0.03
IGL02138:Ube2o APN 11 116543400 splice site probably benign
IGL02317:Ube2o APN 11 116541563 missense probably damaging 1.00
IGL02515:Ube2o APN 11 116543699 missense probably damaging 1.00
IGL02535:Ube2o APN 11 116541765 missense probably benign 0.00
IGL03062:Ube2o APN 11 116541642 missense probably damaging 0.99
IGL03145:Ube2o APN 11 116544009 missense probably damaging 1.00
IGL03190:Ube2o APN 11 116545128 missense probably damaging 1.00
Delay UTSW 11 116540072 missense probably damaging 1.00
Tarry UTSW 11 116541368 missense probably damaging 1.00
ANU05:Ube2o UTSW 11 116540134 missense probably damaging 1.00
R0519:Ube2o UTSW 11 116546459 critical splice donor site probably null
R0666:Ube2o UTSW 11 116542835 missense probably damaging 1.00
R1056:Ube2o UTSW 11 116546464 missense probably damaging 1.00
R1202:Ube2o UTSW 11 116541582 missense probably damaging 1.00
R1424:Ube2o UTSW 11 116543732 missense probably benign
R1469:Ube2o UTSW 11 116545824 splice site probably benign
R1720:Ube2o UTSW 11 116544607 missense probably benign
R1791:Ube2o UTSW 11 116541494 missense probably benign 0.01
R1893:Ube2o UTSW 11 116548835 missense possibly damaging 0.68
R1997:Ube2o UTSW 11 116545337 missense probably damaging 0.99
R2156:Ube2o UTSW 11 116581146 missense probably damaging 0.98
R2199:Ube2o UTSW 11 116544745 missense probably benign
R2414:Ube2o UTSW 11 116548857 missense probably benign 0.02
R3766:Ube2o UTSW 11 116546863 splice site probably benign
R4749:Ube2o UTSW 11 116541908 missense probably benign 0.11
R5213:Ube2o UTSW 11 116541459 missense possibly damaging 0.82
R5403:Ube2o UTSW 11 116548807 missense possibly damaging 0.48
R5441:Ube2o UTSW 11 116544442 missense probably damaging 1.00
R5727:Ube2o UTSW 11 116539670 missense probably damaging 1.00
R6125:Ube2o UTSW 11 116541378 missense probably damaging 1.00
R6125:Ube2o UTSW 11 116544750 missense possibly damaging 0.50
R6234:Ube2o UTSW 11 116539490 missense probably benign 0.17
R6278:Ube2o UTSW 11 116539543 missense probably damaging 1.00
R6346:Ube2o UTSW 11 116541368 missense probably damaging 1.00
R6389:Ube2o UTSW 11 116548858 missense probably null 0.72
R7040:Ube2o UTSW 11 116541860 missense probably benign 0.08
R7072:Ube2o UTSW 11 116541501 missense probably benign 0.13
R7270:Ube2o UTSW 11 116543935 missense possibly damaging 0.62
R7420:Ube2o UTSW 11 116540072 missense probably damaging 1.00
R7593:Ube2o UTSW 11 116581079 missense possibly damaging 0.73
R7818:Ube2o UTSW 11 116543910 missense probably damaging 1.00
R7916:Ube2o UTSW 11 116581058 missense probably benign
R8212:Ube2o UTSW 11 116548798 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GAAGCCGATGTCAGGGTAAC -3'
(R):5'- CTTCGAACAGGAGATTCGGC -3'

Sequencing Primer
(F):5'- TCTTCTCAGGCAGGAAGCTG -3'
(R):5'- AGATTCGGCAGCACTTCAG -3'
Posted On2018-04-02