Mutagenetix > Incidental Mutations

Incidental Mutation 'R6324:Ptprg'

510667

Institutional Source

Beutler Lab

Gene Symbol

Ptprg

Ensembl Gene

ENSMUSG00000021745

Gene Name

protein tyrosine phosphatase, receptor type, G

Synonyms

5430405N12Rik, RPTPgamma

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6324 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11553532-12242041 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12226314 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 527 (D527E)

Ref Sequence

ENSEMBL: ENSMUSP00000113679 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000119888] [ENSMUST00000142917]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022264
AA Change: D1302E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745
AA Change: D1302E

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	321	6.38e-109	SMART
FN3	347	433	5.4e-7	SMART
low complexity region	474	484	N/A	INTRINSIC
low complexity region	515	525	N/A	INTRINSIC
coiled coil region	581	617	N/A	INTRINSIC
transmembrane domain	734	756	N/A	INTRINSIC
PTPc	844	1118	1.76e-136	SMART
PTPc	1146	1409	1.32e-85	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119888
AA Change: D527E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000113679
Gene: ENSMUSG00000021745
AA Change: D527E

Domain	Start	End	E-Value	Type
PTPc	69	343	1.76e-136	SMART
PTPc	371	634	1.32e-85	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134290

Predicted Effect

probably benign
Transcript: ENSMUST00000142917

SMART Domains

Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	260	1.6e-50	SMART

Meta Mutation Damage Score

0.3564

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025F22Rik	T	A	19: 11,163,447	M3L	probably benign	Het
Arhgef4	G	A	1: 34,723,477	A605T	unknown	Het
Atp13a3	A	G	16: 30,332,285	V1069A	possibly damaging	Het
Atp1a2	C	G	1: 172,289,336	R238P	probably damaging	Het
Baz2b	A	G	2: 59,906,948	S1877P	probably damaging	Het
Ccdc114	A	G	7: 45,941,710	E203G	probably damaging	Het
Ccdc27	A	T	4: 154,036,191	S383T	probably benign	Het
Cr1l	A	G	1: 195,111,122	V377A	probably benign	Het
Dazap1	A	G	10: 80,277,660	E130G	probably benign	Het
Dchs1	G	T	7: 105,764,938	A890E	probably benign	Het
Dock10	G	A	1: 80,505,176	T2143I	probably benign	Het
Eif3j1	A	G	2: 122,041,178	D60G	probably benign	Het
Enah	A	G	1: 181,918,571	S382P	probably damaging	Het
Fam171b	A	T	2: 83,879,264	K427*	probably null	Het
Fmn2	A	T	1: 174,612,553	I1179L	possibly damaging	Het
Focad	C	T	4: 88,401,068	R1505*	probably null	Het
Frem1	T	C	4: 82,983,337	T985A	probably benign	Het
Gm3404	A	T	5: 146,528,107	Q219L	possibly damaging	Het
Gm5592	A	C	7: 41,286,535	S154R	probably damaging	Het
Gpn3	C	T	5: 122,372,575		probably benign	Het
Gpr158	A	G	2: 21,810,554	E586G	probably damaging	Het
Gstp2	A	T	19: 4,040,499	I162N	probably benign	Het
Lin7a	T	A	10: 107,380,215		probably null	Het
Loxl4	G	A	19: 42,595,378	L745F	probably benign	Het
Mybpc1	A	G	10: 88,568,619	I172T	possibly damaging	Het
Nalcn	A	G	14: 123,409,749	W571R	possibly damaging	Het
Nkx2-5	G	C	17: 26,841,121	P79A	probably benign	Het
Nufip2	A	G	11: 77,691,661	T134A	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1342	G	A	4: 118,690,531		probably benign	Het
Olfr1463	A	G	19: 13,235,104	M285V	possibly damaging	Het
Phkb	A	G	8: 86,018,542	D616G	probably benign	Het
Plch1	C	T	3: 63,781,390	W131*	probably null	Het
Prl7b1	A	T	13: 27,602,895		probably null	Het
Prop1	G	A	11: 50,952,199	P54S	probably benign	Het
Ptcd3	C	T	6: 71,885,327	V509I	probably benign	Het
Rapgef2	C	T	3: 79,079,132	V1182I	probably benign	Het
Rfx7	C	A	9: 72,618,414	P962Q	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Slc38a9	A	G	13: 112,726,100	I444M	probably benign	Het
Sorbs1	T	C	19: 40,321,819	T492A	probably damaging	Het
Synj1	A	T	16: 90,938,630	S1478R	probably benign	Het
Tnn	T	A	1: 160,145,204	N276I	probably damaging	Het
Trbv19	G	A	6: 41,178,758	G21D	probably damaging	Het
Ube2o	A	T	11: 116,539,359	D1184E	probably benign	Het
Vmn1r181	G	A	7: 23,984,758	R216Q	probably benign	Het
Vmn2r108	A	T	17: 20,471,715	L182*	probably null	Het
Vmn2r15	A	G	5: 109,286,271	*856R	probably null	Het
Vmn2r70	G	A	7: 85,558,879	H797Y	probably benign	Het
Zfp11	C	T	5: 129,656,523	A625T	possibly damaging	Het

Other mutations in Ptprg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Ptprg	APN	14	12215992	missense	probably damaging	1.00
IGL00484:Ptprg	APN	14	12215220	missense	probably damaging	0.99
IGL00847:Ptprg	APN	14	12215265	missense	probably damaging	1.00
IGL01089:Ptprg	APN	14	12215286	missense	probably damaging	0.97
IGL01382:Ptprg	APN	14	12237797	missense	probably benign	0.16
IGL01470:Ptprg	APN	14	12213702	nonsense	probably null
IGL01762:Ptprg	APN	14	12037386	missense	probably benign	0.00
IGL01886:Ptprg	APN	14	12179280	missense	probably benign	0.22
IGL01963:Ptprg	APN	14	12220661	missense	probably damaging	1.00
IGL02015:Ptprg	APN	14	12237782	missense	possibly damaging	0.46
IGL02086:Ptprg	APN	14	12110080	nonsense	probably null
IGL02197:Ptprg	APN	14	12220613	missense	probably damaging	0.98
IGL02341:Ptprg	APN	14	12154360	missense	probably benign	0.00
IGL02732:Ptprg	APN	14	12225617	critical splice donor site	probably null
IGL03011:Ptprg	APN	14	12219029	missense	probably damaging	1.00
IGL03261:Ptprg	APN	14	12225552	missense	probably damaging	0.99
R0038:Ptprg	UTSW	14	12213710	missense	probably damaging	1.00
R0383:Ptprg	UTSW	14	12219024	missense	possibly damaging	0.93
R0433:Ptprg	UTSW	14	12220620	missense	probably damaging	1.00
R0488:Ptprg	UTSW	14	12220653	missense	probably damaging	1.00
R0503:Ptprg	UTSW	14	12237138	missense	possibly damaging	0.89
R0520:Ptprg	UTSW	14	12199783	missense	possibly damaging	0.92
R0570:Ptprg	UTSW	14	12215896	missense	probably damaging	1.00
R0606:Ptprg	UTSW	14	12154131	missense	probably benign
R1086:Ptprg	UTSW	14	11952706	splice site	probably benign
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1519:Ptprg	UTSW	14	12220596	missense	probably damaging	1.00
R1662:Ptprg	UTSW	14	12207357	missense	probably damaging	1.00
R1714:Ptprg	UTSW	14	12213697	missense	probably damaging	1.00
R1716:Ptprg	UTSW	14	12154360	missense	probably benign	0.00
R1797:Ptprg	UTSW	14	12199743	missense	probably damaging	1.00
R1803:Ptprg	UTSW	14	12091410	splice site	probably null
R2104:Ptprg	UTSW	14	11952897	critical splice donor site	probably null
R2125:Ptprg	UTSW	14	12179283	missense	possibly damaging	0.74
R2126:Ptprg	UTSW	14	12154355	missense	probably benign
R2133:Ptprg	UTSW	14	12211637	missense	probably damaging	1.00
R2471:Ptprg	UTSW	14	12210327	missense	probably damaging	1.00
R2571:Ptprg	UTSW	14	12122135	missense	probably benign
R3821:Ptprg	UTSW	14	12226375	missense	probably benign	0.00
R4196:Ptprg	UTSW	14	12122002	missense	possibly damaging	0.51
R4392:Ptprg	UTSW	14	12142467	missense	possibly damaging	0.80
R4665:Ptprg	UTSW	14	12215288	missense	possibly damaging	0.90
R4730:Ptprg	UTSW	14	12213713	missense	probably damaging	1.00
R4737:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R4764:Ptprg	UTSW	14	12122068	missense	probably benign	0.01
R4801:Ptprg	UTSW	14	11554233	utr 5 prime	probably benign
R4825:Ptprg	UTSW	14	12220654	missense	probably damaging	1.00
R4960:Ptprg	UTSW	14	12237837	missense	probably benign	0.07
R4972:Ptprg	UTSW	14	12226427	missense	possibly damaging	0.94
R4980:Ptprg	UTSW	14	12154421	missense	probably benign	0.16
R5004:Ptprg	UTSW	14	12220667	missense	probably damaging	1.00
R5058:Ptprg	UTSW	14	12037387	missense	possibly damaging	0.82
R5182:Ptprg	UTSW	14	12154174	missense	probably benign
R5258:Ptprg	UTSW	14	12142431	missense	probably benign	0.11
R5338:Ptprg	UTSW	14	12154111	missense	probably benign
R5353:Ptprg	UTSW	14	11554235	utr 5 prime	probably benign
R5373:Ptprg	UTSW	14	12213665	missense	probably benign	0.00
R5387:Ptprg	UTSW	14	12153873	missense	probably damaging	1.00
R5616:Ptprg	UTSW	14	12122120	missense	probably benign
R5623:Ptprg	UTSW	14	12153857	missense	probably damaging	1.00
R5976:Ptprg	UTSW	14	12211625	missense	probably damaging	0.96
R6027:Ptprg	UTSW	14	12220613	missense	possibly damaging	0.87
R6091:Ptprg	UTSW	14	12215979	missense	probably damaging	1.00
R6184:Ptprg	UTSW	14	12153943	missense	probably benign	0.00
R6234:Ptprg	UTSW	14	12213747	missense	probably damaging	1.00
R6318:Ptprg	UTSW	14	12237118	missense	probably damaging	1.00
R6334:Ptprg	UTSW	14	12166832	missense	probably damaging	1.00
R6646:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6647:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6992:Ptprg	UTSW	14	11962602	missense	probably damaging	1.00
R7088:Ptprg	UTSW	14	12207365	missense	probably damaging	1.00
R7250:Ptprg	UTSW	14	12166767	missense	probably benign	0.18
R7342:Ptprg	UTSW	14	12237151	missense	possibly damaging	0.90
R7358:Ptprg	UTSW	14	12154198	missense	possibly damaging	0.59
R7410:Ptprg	UTSW	14	11962657	missense	probably damaging	1.00
R7448:Ptprg	UTSW	14	12142461	missense	probably benign	0.12
R7514:Ptprg	UTSW	14	12179342	missense	possibly damaging	0.86
R7523:Ptprg	UTSW	14	12237130	missense	probably damaging	0.97
R7672:Ptprg	UTSW	14	12211668	missense	probably benign	0.04
R7709:Ptprg	UTSW	14	12226452	missense	probably damaging	1.00
R7720:Ptprg	UTSW	14	12211703	missense	probably benign	0.31
X0020:Ptprg	UTSW	14	12110070	frame shift	probably null
X0027:Ptprg	UTSW	14	12110070	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGGGCCATAATATCCCTTACAGG -3'
(R):5'- AAGACAGTGTTCCCTTTGGAC -3'

Sequencing Primer
(F):5'- CATAATATCCCTTACAGGTGTTTTGG -3'
(R):5'- CCTTTGGACTTTTATATGAGTCTCG -3'

Posted On

2018-04-02