Incidental Mutation 'R6324:Nkx2-5'
ID510672
Institutional Source Beutler Lab
Gene Symbol Nkx2-5
Ensembl Gene ENSMUSG00000015579
Gene NameNK2 homeobox 5
SynonymsCsx, Nkx2.5, Nkx-2.5, tinman
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6324 (G1)
Quality Score224.009
Status Validated
Chromosome17
Chromosomal Location26838664-26841565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 26841121 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 79 (P79A)
Ref Sequence ENSEMBL: ENSMUSP00000015723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015723]
Predicted Effect probably benign
Transcript: ENSMUST00000015723
AA Change: P79A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015723
Gene: ENSMUSG00000015579
AA Change: P79A

DomainStartEndE-ValueType
low complexity region 98 110 N/A INTRINSIC
HOX 137 199 1.26e-23 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing transcription factor. This transcription factor functions in heart formation and development. Mutations in this gene cause atrial septal defect with atrioventricular conduction defect, and also tetralogy of Fallot, which are both heart malformation diseases. Mutations in this gene can also cause congenital hypothyroidism non-goitrous type 5, a non-autoimmune condition. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants show cardiac development arrest after looping, growth retardation, hematopoiesis and angiogenesis defects in yolk sac, and die at embryonic day 9-10. Heterozygotes also show cardiac developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Nkx2-5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1464:Nkx2-5 UTSW 17 26839279 missense probably benign 0.01
R1464:Nkx2-5 UTSW 17 26839279 missense probably benign 0.01
R5836:Nkx2-5 UTSW 17 26839089 missense possibly damaging 0.82
R6868:Nkx2-5 UTSW 17 26841294 missense probably damaging 1.00
R7223:Nkx2-5 UTSW 17 26839620 missense possibly damaging 0.94
R7962:Nkx2-5 UTSW 17 26839176 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCCTGGAATCTTATACTCCAAAC -3'
(R):5'- ACATCCTGAACCTGGAGCAG -3'

Sequencing Primer
(F):5'- ACTGAGCTACTGTCAGGCCTG -3'
(R):5'- ACCTGGAGCAGCAGCAG -3'
Posted On2018-04-02