Incidental Mutation 'R6324:Loxl4'
ID510677
Institutional Source Beutler Lab
Gene Symbol Loxl4
Ensembl Gene ENSMUSG00000025185
Gene Namelysyl oxidase-like 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6324 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location42593982-42612813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42595378 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 745 (L745F)
Ref Sequence ENSEMBL: ENSMUSP00000125803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026188] [ENSMUST00000026190] [ENSMUST00000160107] [ENSMUST00000164786] [ENSMUST00000171432]
Predicted Effect probably benign
Transcript: ENSMUST00000026188
SMART Domains Protein: ENSMUSP00000026188
Gene: ENSMUSG00000025184

DomainStartEndE-ValueType
low complexity region 163 178 N/A INTRINSIC
low complexity region 694 706 N/A INTRINSIC
coiled coil region 734 766 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026190
AA Change: L744F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026190
Gene: ENSMUSG00000025185
AA Change: L744F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 312 412 2.6e-41 SMART
SR 422 530 5.41e-30 SMART
Pfam:Lysyl_oxidase 534 737 1.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160107
SMART Domains Protein: ENSMUSP00000124036
Gene: ENSMUSG00000025184

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
coiled coil region 154 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164786
AA Change: L745F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125803
Gene: ENSMUSG00000025185
AA Change: L745F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 313 413 2.6e-41 SMART
SR 423 531 5.41e-30 SMART
Pfam:Lysyl_oxidase 535 735 1.8e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171432
AA Change: L744F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126686
Gene: ENSMUSG00000025185
AA Change: L744F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 312 412 2.6e-41 SMART
SR 422 530 5.41e-30 SMART
Pfam:Lysyl_oxidase 534 737 1.3e-113 PFAM
Meta Mutation Damage Score 0.0649 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Loxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Loxl4 APN 19 42597549 missense probably damaging 1.00
IGL02063:Loxl4 APN 19 42608339 missense probably benign 0.03
IGL02490:Loxl4 APN 19 42604830 missense probably benign
IGL02498:Loxl4 APN 19 42604973 missense probably benign 0.27
IGL03107:Loxl4 APN 19 42605279 missense probably benign 0.12
IGL03296:Loxl4 APN 19 42598823 splice site probably benign
R1145:Loxl4 UTSW 19 42608555 unclassified probably benign
R1697:Loxl4 UTSW 19 42604940 missense possibly damaging 0.86
R2126:Loxl4 UTSW 19 42603963 missense probably damaging 1.00
R2128:Loxl4 UTSW 19 42603963 missense probably damaging 1.00
R2148:Loxl4 UTSW 19 42604192 splice site probably null
R2159:Loxl4 UTSW 19 42600007 missense probably damaging 1.00
R3624:Loxl4 UTSW 19 42607576 missense probably benign 0.28
R4030:Loxl4 UTSW 19 42608359 missense probably damaging 1.00
R4181:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4302:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4700:Loxl4 UTSW 19 42607613 missense probably benign 0.07
R4701:Loxl4 UTSW 19 42607613 missense probably benign 0.07
R4719:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4724:Loxl4 UTSW 19 42608346 missense probably benign 0.23
R4750:Loxl4 UTSW 19 42605004 missense probably damaging 1.00
R4953:Loxl4 UTSW 19 42610694 unclassified probably benign
R5579:Loxl4 UTSW 19 42604290 missense probably damaging 1.00
R5840:Loxl4 UTSW 19 42598715 missense probably damaging 1.00
R5856:Loxl4 UTSW 19 42595366 missense possibly damaging 0.89
R5879:Loxl4 UTSW 19 42607627 missense probably benign 0.09
R6137:Loxl4 UTSW 19 42598793 missense probably damaging 1.00
R6180:Loxl4 UTSW 19 42608352 missense probably damaging 1.00
R6347:Loxl4 UTSW 19 42608270 missense probably damaging 1.00
R6646:Loxl4 UTSW 19 42598781 missense probably damaging 1.00
R6788:Loxl4 UTSW 19 42608353 missense probably damaging 1.00
R7045:Loxl4 UTSW 19 42606635 missense probably damaging 1.00
R8013:Loxl4 UTSW 19 42607676 missense probably damaging 1.00
R8072:Loxl4 UTSW 19 42607582 missense probably damaging 1.00
R8546:Loxl4 UTSW 19 42607588 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGATCTGGCCACCGAAAG -3'
(R):5'- TGACTTACCAGGTGGAAACC -3'

Sequencing Primer
(F):5'- AAAGGCCTCCTGAGCAGCTTC -3'
(R):5'- CTTACCAGGTGGAAACCAGGGG -3'
Posted On2018-04-02