Incidental Mutation 'R6334:Rpl35'
ID510683
Institutional Source Beutler Lab
Gene Symbol Rpl35
Ensembl Gene ENSMUSG00000062997
Gene Nameribosomal protein L35
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R6334 (G1)
Quality Score193.009
Status Validated
Chromosome2
Chromosomal Location39001580-39005624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 39001742 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 82 (D82E)
Ref Sequence ENSEMBL: ENSMUSP00000079672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039535] [ENSMUST00000080861] [ENSMUST00000112872]
Predicted Effect probably benign
Transcript: ENSMUST00000039535
SMART Domains Protein: ENSMUSP00000043834
Gene: ENSMUSG00000035295

DomainStartEndE-ValueType
WD40 15 54 9.67e-7 SMART
WD40 57 96 9.22e-13 SMART
WD40 99 138 4.4e-10 SMART
WD40 141 180 1.21e-7 SMART
WD40 186 224 9.97e-9 SMART
WD40 227 266 4.34e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000080861
AA Change: D82E

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079672
Gene: ENSMUSG00000062997
AA Change: D82E

DomainStartEndE-ValueType
Pfam:Ribosomal_L29 7 63 2.7e-22 PFAM
low complexity region 95 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112872
SMART Domains Protein: ENSMUSP00000108493
Gene: ENSMUSG00000035295

DomainStartEndE-ValueType
WD40 15 54 9.67e-7 SMART
WD40 57 96 9.22e-13 SMART
WD40 99 138 4.4e-10 SMART
WD40 141 180 1.21e-7 SMART
WD40 186 224 9.97e-9 SMART
WD40 227 266 4.34e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152441
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,114 S141T probably benign Het
Afap1l2 A G 19: 56,917,976 probably null Het
Aox2 C T 1: 58,307,407 Q567* probably null Het
Aqp4 T A 18: 15,393,591 M278L probably benign Het
Atp23 A C 10: 126,887,669 L188R probably benign Het
B230359F08Rik A G 14: 53,795,942 T103A probably damaging Het
Catsperg1 C T 7: 29,206,357 G215D probably benign Het
Cavin4 T C 4: 48,663,824 V68A possibly damaging Het
Ccl4 T C 11: 83,662,678 S6P unknown Het
Cfap46 T C 7: 139,680,831 E117G probably damaging Het
Chek1 A G 9: 36,714,492 S286P possibly damaging Het
Cntn4 G A 6: 106,344,786 V35I probably benign Het
Cntn4 C A 6: 106,506,192 P236Q probably benign Het
Cyp2d40 C A 15: 82,761,552 G84V probably benign Het
Dnah12 A T 14: 26,706,834 H205L possibly damaging Het
Dock1 G A 7: 134,851,576 V845I probably benign Het
Drg1 T C 11: 3,266,292 K7E possibly damaging Het
Eloa G A 4: 136,009,822 P488S probably damaging Het
Evi5 G A 5: 107,820,521 R187* probably null Het
Fam53a T A 5: 33,600,875 L301F probably damaging Het
Fmnl3 T C 15: 99,337,653 K63E probably damaging Het
Gast C A 11: 100,336,612 Q44K probably benign Het
Gm4788 A G 1: 139,773,924 probably null Het
Gng10 T A 4: 59,035,257 V7E probably benign Het
Gtf3c5 G A 2: 28,570,462 T375I probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hspa14 A T 2: 3,489,072 probably null Het
Kcna3 T C 3: 107,036,424 M1T probably null Het
Kcnj15 T G 16: 95,296,236 L239R probably damaging Het
Klhl2 G T 8: 64,759,808 D232E probably benign Het
Lamb3 A T 1: 193,335,474 I888F probably damaging Het
Lars C A 18: 42,217,486 M919I probably benign Het
Lfng T C 5: 140,612,767 V247A possibly damaging Het
Lrp1b C T 2: 41,789,033 A16T probably benign Het
Mamdc2 A T 19: 23,363,906 I235N probably damaging Het
Map9 T A 3: 82,383,305 L492Q probably damaging Het
Mcpt8 A G 14: 56,085,147 V14A possibly damaging Het
Myo1b T C 1: 51,768,651 K823R probably null Het
Nbea G T 3: 56,037,149 T598K probably damaging Het
Nrcam C A 12: 44,572,300 H877N probably benign Het
Nrxn2 T C 19: 6,531,292 probably null Het
Nwd2 A T 5: 63,800,253 I309F possibly damaging Het
Phyhd1 G A 2: 30,274,724 probably null Het
Pkp2 C T 16: 16,226,069 T229I probably damaging Het
Plagl2 G A 2: 153,232,691 P97S probably benign Het
Plekhh2 C A 17: 84,566,866 N526K probably benign Het
Plin4 A G 17: 56,103,261 L1217P probably benign Het
Polr3e T C 7: 120,927,999 S67P possibly damaging Het
Postn A G 3: 54,385,282 K757E probably benign Het
Prpf39 T A 12: 65,042,813 probably null Het
Ptprg C T 14: 12,166,832 T745I probably damaging Het
Pxylp1 C G 9: 96,825,254 A292P probably damaging Het
Slc9a1 G A 4: 133,422,208 V782I possibly damaging Het
Syn2 T A 6: 115,263,914 M415K possibly damaging Het
Tmem117 A C 15: 95,011,443 I246L probably benign Het
Tmem221 A T 8: 71,558,784 V9E probably damaging Het
Ubxn7 T A 16: 32,372,189 probably null Het
Vmn2r101 G T 17: 19,589,850 M299I possibly damaging Het
Vmn2r103 T A 17: 19,794,082 S379T probably damaging Het
Vmn2r109 T C 17: 20,541,178 N639S probably benign Het
Wdr26 T C 1: 181,203,206 Het
Zfp109 T A 7: 24,228,883 Y367F probably damaging Het
Zfp143 G A 7: 110,086,131 C389Y probably damaging Het
Zfp553 G T 7: 127,236,892 probably null Het
Other mutations in Rpl35
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2064:Rpl35 UTSW 2 39004741 missense possibly damaging 0.88
R6011:Rpl35 UTSW 2 39004801 unclassified probably null
R7113:Rpl35 UTSW 2 39004156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGGCAAGTGGTCACCTG -3'
(R):5'- CAACCTCTGCTAACCTTATTTGACG -3'

Sequencing Primer
(F):5'- CAGGCGGCCAATGTAAAAC -3'
(R):5'- AACCTTATTTGACGGCCCCCAG -3'
Posted On2018-04-02