Incidental Mutation 'R6334:Syn2'
ID510700
Institutional Source Beutler Lab
Gene Symbol Syn2
Ensembl Gene ENSMUSG00000009394
Gene Namesynapsin II
SynonymsSynapsin IIb, 2900074L19Rik, Synapsin IIa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R6334 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location115134902-115282006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115263914 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 415 (M415K)
Ref Sequence ENSEMBL: ENSMUSP00000144921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009538] [ENSMUST00000166681] [ENSMUST00000169345] [ENSMUST00000203450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009538
AA Change: M415K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000009538
Gene: ENSMUSG00000009394
AA Change: M415K

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 3.4e-24 PFAM
Pfam:Synapsin 112 213 6.4e-48 PFAM
Pfam:Synapsin_C 215 417 8.2e-140 PFAM
low complexity region 450 470 N/A INTRINSIC
low complexity region 473 507 N/A INTRINSIC
low complexity region 524 540 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166681
Predicted Effect possibly damaging
Transcript: ENSMUST00000169345
AA Change: M415K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133121
Gene: ENSMUSG00000009394
AA Change: M415K

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 1.3e-24 PFAM
Pfam:Synapsin 109 213 1.6e-62 PFAM
Pfam:Synapsin_C 215 417 4.4e-133 PFAM
Pfam:RimK 247 403 4.5e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203450
AA Change: M415K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144921
Gene: ENSMUSG00000009394
AA Change: M415K

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 2.7e-24 PFAM
Pfam:Synapsin 112 213 4.6e-48 PFAM
Pfam:Synapsin_C 215 417 5.3e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204726
Meta Mutation Damage Score 0.6183 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. This member of the synapsin family encodes a neuron-specific phosphoprotein that selectively binds to small synaptic vesicles in the presynaptic nerve terminal. Polymorphisms in this gene are associated with abnormal presynaptic function and related neuronal disorders, including autism, epilepsy, bipolar disorder and schizophrenia. Alternative splicing of this gene results in multiple transcript variants. The tissue inhibitor of metalloproteinase 4 gene is located within an intron of this gene and is transcribed in the opposite direction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in central nervous system abnormalities. One model showed delayed synapse formation and decreased brain weight while another allele showed decreased post-tetanic potentiation and increased synaptic depression and development of convulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,114 S141T probably benign Het
Afap1l2 A G 19: 56,917,976 probably null Het
Aox2 C T 1: 58,307,407 Q567* probably null Het
Aqp4 T A 18: 15,393,591 M278L probably benign Het
Atp23 A C 10: 126,887,669 L188R probably benign Het
B230359F08Rik A G 14: 53,795,942 T103A probably damaging Het
Catsperg1 C T 7: 29,206,357 G215D probably benign Het
Cavin4 T C 4: 48,663,824 V68A possibly damaging Het
Ccl4 T C 11: 83,662,678 S6P unknown Het
Cfap46 T C 7: 139,680,831 E117G probably damaging Het
Chek1 A G 9: 36,714,492 S286P possibly damaging Het
Cntn4 G A 6: 106,344,786 V35I probably benign Het
Cntn4 C A 6: 106,506,192 P236Q probably benign Het
Cyp2d40 C A 15: 82,761,552 G84V probably benign Het
Dnah12 A T 14: 26,706,834 H205L possibly damaging Het
Dock1 G A 7: 134,851,576 V845I probably benign Het
Drg1 T C 11: 3,266,292 K7E possibly damaging Het
Eloa G A 4: 136,009,822 P488S probably damaging Het
Evi5 G A 5: 107,820,521 R187* probably null Het
Fam53a T A 5: 33,600,875 L301F probably damaging Het
Fmnl3 T C 15: 99,337,653 K63E probably damaging Het
Gast C A 11: 100,336,612 Q44K probably benign Het
Gm4788 A G 1: 139,773,924 probably null Het
Gng10 T A 4: 59,035,257 V7E probably benign Het
Gtf3c5 G A 2: 28,570,462 T375I probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hspa14 A T 2: 3,489,072 probably null Het
Kcna3 T C 3: 107,036,424 M1T probably null Het
Kcnj15 T G 16: 95,296,236 L239R probably damaging Het
Klhl2 G T 8: 64,759,808 D232E probably benign Het
Lamb3 A T 1: 193,335,474 I888F probably damaging Het
Lars C A 18: 42,217,486 M919I probably benign Het
Lfng T C 5: 140,612,767 V247A possibly damaging Het
Lrp1b C T 2: 41,789,033 A16T probably benign Het
Mamdc2 A T 19: 23,363,906 I235N probably damaging Het
Map9 T A 3: 82,383,305 L492Q probably damaging Het
Mcpt8 A G 14: 56,085,147 V14A possibly damaging Het
Myo1b T C 1: 51,768,651 K823R probably null Het
Nbea G T 3: 56,037,149 T598K probably damaging Het
Nrcam C A 12: 44,572,300 H877N probably benign Het
Nrxn2 T C 19: 6,531,292 probably null Het
Nwd2 A T 5: 63,800,253 I309F possibly damaging Het
Phyhd1 G A 2: 30,274,724 probably null Het
Pkp2 C T 16: 16,226,069 T229I probably damaging Het
Plagl2 G A 2: 153,232,691 P97S probably benign Het
Plekhh2 C A 17: 84,566,866 N526K probably benign Het
Plin4 A G 17: 56,103,261 L1217P probably benign Het
Polr3e T C 7: 120,927,999 S67P possibly damaging Het
Postn A G 3: 54,385,282 K757E probably benign Het
Prpf39 T A 12: 65,042,813 probably null Het
Ptprg C T 14: 12,166,832 T745I probably damaging Het
Pxylp1 C G 9: 96,825,254 A292P probably damaging Het
Rpl35 G T 2: 39,001,742 D82E possibly damaging Het
Slc9a1 G A 4: 133,422,208 V782I possibly damaging Het
Tmem117 A C 15: 95,011,443 I246L probably benign Het
Tmem221 A T 8: 71,558,784 V9E probably damaging Het
Ubxn7 T A 16: 32,372,189 probably null Het
Vmn2r101 G T 17: 19,589,850 M299I possibly damaging Het
Vmn2r103 T A 17: 19,794,082 S379T probably damaging Het
Vmn2r109 T C 17: 20,541,178 N639S probably benign Het
Wdr26 T C 1: 181,203,206 Het
Zfp109 T A 7: 24,228,883 Y367F probably damaging Het
Zfp143 G A 7: 110,086,131 C389Y probably damaging Het
Zfp553 G T 7: 127,236,892 probably null Het
Other mutations in Syn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03040:Syn2 APN 6 115263965 missense possibly damaging 0.92
IGL03328:Syn2 APN 6 115274260 missense probably damaging 0.97
R0044:Syn2 UTSW 6 115135147 missense unknown
R0267:Syn2 UTSW 6 115254150 unclassified probably benign
R2026:Syn2 UTSW 6 115278251 missense probably benign 0.01
R2290:Syn2 UTSW 6 115274229 missense possibly damaging 0.91
R2900:Syn2 UTSW 6 115237334 missense possibly damaging 0.74
R3949:Syn2 UTSW 6 115227329 unclassified probably null
R3983:Syn2 UTSW 6 115237298 missense probably benign 0.01
R5101:Syn2 UTSW 6 115263899 missense probably damaging 1.00
R5502:Syn2 UTSW 6 115278352 missense possibly damaging 0.96
R6546:Syn2 UTSW 6 115281098 missense probably benign 0.18
R6766:Syn2 UTSW 6 115239401 missense probably damaging 0.97
R7491:Syn2 UTSW 6 115254654 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGAAACAAACGGTTCCTGTCTC -3'
(R):5'- ATAGAACTGTGGATCCCAGCAC -3'

Sequencing Primer
(F):5'- TCTGCTGAGGAACACCATTCTAG -3'
(R):5'- TGGATCCCAGCACGTATCTGAC -3'
Posted On2018-04-02