Incidental Mutation 'R6334:Cfap46'
ID510708
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Namecilia and flagella associated protein 46
Synonyms9330101J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6334 (G1)
Quality Score160.009
Status Validated
Chromosome7
Chromosomal Location139600951-139683817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139680831 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 117 (E117G)
Ref Sequence ENSEMBL: ENSMUSP00000115437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000130453] [ENSMUST00000140820]
Predicted Effect probably damaging
Transcript: ENSMUST00000129990
AA Change: E176G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: E176G

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130453
AA Change: E117G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115437
Gene: ENSMUSG00000049571
AA Change: E117G

DomainStartEndE-ValueType
Blast:TPR 116 149 1e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138129
Predicted Effect probably damaging
Transcript: ENSMUST00000140820
AA Change: E176G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571
AA Change: E176G

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156116
Meta Mutation Damage Score 0.1802 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,114 S141T probably benign Het
Afap1l2 A G 19: 56,917,976 probably null Het
Aox2 C T 1: 58,307,407 Q567* probably null Het
Aqp4 T A 18: 15,393,591 M278L probably benign Het
Atp23 A C 10: 126,887,669 L188R probably benign Het
B230359F08Rik A G 14: 53,795,942 T103A probably damaging Het
Catsperg1 C T 7: 29,206,357 G215D probably benign Het
Cavin4 T C 4: 48,663,824 V68A possibly damaging Het
Ccl4 T C 11: 83,662,678 S6P unknown Het
Chek1 A G 9: 36,714,492 S286P possibly damaging Het
Cntn4 G A 6: 106,344,786 V35I probably benign Het
Cntn4 C A 6: 106,506,192 P236Q probably benign Het
Cyp2d40 C A 15: 82,761,552 G84V probably benign Het
Dnah12 A T 14: 26,706,834 H205L possibly damaging Het
Dock1 G A 7: 134,851,576 V845I probably benign Het
Drg1 T C 11: 3,266,292 K7E possibly damaging Het
Eloa G A 4: 136,009,822 P488S probably damaging Het
Evi5 G A 5: 107,820,521 R187* probably null Het
Fam53a T A 5: 33,600,875 L301F probably damaging Het
Fmnl3 T C 15: 99,337,653 K63E probably damaging Het
Gast C A 11: 100,336,612 Q44K probably benign Het
Gm4788 A G 1: 139,773,924 probably null Het
Gng10 T A 4: 59,035,257 V7E probably benign Het
Gtf3c5 G A 2: 28,570,462 T375I probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hspa14 A T 2: 3,489,072 probably null Het
Kcna3 T C 3: 107,036,424 M1T probably null Het
Kcnj15 T G 16: 95,296,236 L239R probably damaging Het
Klhl2 G T 8: 64,759,808 D232E probably benign Het
Lamb3 A T 1: 193,335,474 I888F probably damaging Het
Lars C A 18: 42,217,486 M919I probably benign Het
Lfng T C 5: 140,612,767 V247A possibly damaging Het
Lrp1b C T 2: 41,789,033 A16T probably benign Het
Mamdc2 A T 19: 23,363,906 I235N probably damaging Het
Map9 T A 3: 82,383,305 L492Q probably damaging Het
Mcpt8 A G 14: 56,085,147 V14A possibly damaging Het
Myo1b T C 1: 51,768,651 K823R probably null Het
Nbea G T 3: 56,037,149 T598K probably damaging Het
Nrcam C A 12: 44,572,300 H877N probably benign Het
Nrxn2 T C 19: 6,531,292 probably null Het
Nwd2 A T 5: 63,800,253 I309F possibly damaging Het
Phyhd1 G A 2: 30,274,724 probably null Het
Pkp2 C T 16: 16,226,069 T229I probably damaging Het
Plagl2 G A 2: 153,232,691 P97S probably benign Het
Plekhh2 C A 17: 84,566,866 N526K probably benign Het
Plin4 A G 17: 56,103,261 L1217P probably benign Het
Polr3e T C 7: 120,927,999 S67P possibly damaging Het
Postn A G 3: 54,385,282 K757E probably benign Het
Prpf39 T A 12: 65,042,813 probably null Het
Ptprg C T 14: 12,166,832 T745I probably damaging Het
Pxylp1 C G 9: 96,825,254 A292P probably damaging Het
Rpl35 G T 2: 39,001,742 D82E possibly damaging Het
Slc9a1 G A 4: 133,422,208 V782I possibly damaging Het
Syn2 T A 6: 115,263,914 M415K possibly damaging Het
Tmem117 A C 15: 95,011,443 I246L probably benign Het
Tmem221 A T 8: 71,558,784 V9E probably damaging Het
Ubxn7 T A 16: 32,372,189 probably null Het
Vmn2r101 G T 17: 19,589,850 M299I possibly damaging Het
Vmn2r103 T A 17: 19,794,082 S379T probably damaging Het
Vmn2r109 T C 17: 20,541,178 N639S probably benign Het
Wdr26 T C 1: 181,203,206 Het
Zfp109 T A 7: 24,228,883 Y367F probably damaging Het
Zfp143 G A 7: 110,086,131 C389Y probably damaging Het
Zfp553 G T 7: 127,236,892 probably null Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATCCCGATGTGTCTTTAAGGCG -3'
(R):5'- TCCTGAATGGGTCCAGGAAC -3'

Sequencing Primer
(F):5'- TAAGGCGTGTGGCAATATCC -3'
(R):5'- GGTCCAGGAACCCGGATAC -3'
Posted On2018-04-02