Incidental Mutation 'R6334:Chek1'
ID510711
Institutional Source Beutler Lab
Gene Symbol Chek1
Ensembl Gene ENSMUSG00000032113
Gene Namecheckpoint kinase 1
SynonymsChk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6334 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location36708482-36727065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36714492 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 286 (S286P)
Ref Sequence ENSEMBL: ENSMUSP00000134388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034625] [ENSMUST00000172702] [ENSMUST00000173963]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034625
AA Change: S286P

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034625
Gene: ENSMUSG00000032113
AA Change: S286P

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172702
AA Change: S286P

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134388
Gene: ENSMUSG00000032113
AA Change: S286P

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173963
AA Change: S286P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134029
Gene: ENSMUSG00000032113
AA Change: S286P

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174105
SMART Domains Protein: ENSMUSP00000134398
Gene: ENSMUSG00000032113

DomainStartEndE-ValueType
STYKc 1 99 4.6e-3 SMART
low complexity region 114 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174794
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr protein kinase family. It is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. This protein acts to integrate signals from ATM and ATR, two cell cycle proteins involved in DNA damage responses, that also associate with chromatin in meiotic prophase I. Phosphorylation of CDC25A protein phosphatase by this protein is required for cells to delay cell cycle progression in response to double-strand DNA breaks. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality between E2.5 and E7.5, impaired cell cycle checkpoint function, increase in blastocyst apoptosis and lack of inner cell mass proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,114 S141T probably benign Het
Afap1l2 A G 19: 56,917,976 probably null Het
Aox2 C T 1: 58,307,407 Q567* probably null Het
Aqp4 T A 18: 15,393,591 M278L probably benign Het
Atp23 A C 10: 126,887,669 L188R probably benign Het
B230359F08Rik A G 14: 53,795,942 T103A probably damaging Het
Catsperg1 C T 7: 29,206,357 G215D probably benign Het
Cavin4 T C 4: 48,663,824 V68A possibly damaging Het
Ccl4 T C 11: 83,662,678 S6P unknown Het
Cfap46 T C 7: 139,680,831 E117G probably damaging Het
Cntn4 G A 6: 106,344,786 V35I probably benign Het
Cntn4 C A 6: 106,506,192 P236Q probably benign Het
Cyp2d40 C A 15: 82,761,552 G84V probably benign Het
Dnah12 A T 14: 26,706,834 H205L possibly damaging Het
Dock1 G A 7: 134,851,576 V845I probably benign Het
Drg1 T C 11: 3,266,292 K7E possibly damaging Het
Eloa G A 4: 136,009,822 P488S probably damaging Het
Evi5 G A 5: 107,820,521 R187* probably null Het
Fam53a T A 5: 33,600,875 L301F probably damaging Het
Fmnl3 T C 15: 99,337,653 K63E probably damaging Het
Gast C A 11: 100,336,612 Q44K probably benign Het
Gm4788 A G 1: 139,773,924 probably null Het
Gng10 T A 4: 59,035,257 V7E probably benign Het
Gtf3c5 G A 2: 28,570,462 T375I probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hspa14 A T 2: 3,489,072 probably null Het
Kcna3 T C 3: 107,036,424 M1T probably null Het
Kcnj15 T G 16: 95,296,236 L239R probably damaging Het
Klhl2 G T 8: 64,759,808 D232E probably benign Het
Lamb3 A T 1: 193,335,474 I888F probably damaging Het
Lars C A 18: 42,217,486 M919I probably benign Het
Lfng T C 5: 140,612,767 V247A possibly damaging Het
Lrp1b C T 2: 41,789,033 A16T probably benign Het
Mamdc2 A T 19: 23,363,906 I235N probably damaging Het
Map9 T A 3: 82,383,305 L492Q probably damaging Het
Mcpt8 A G 14: 56,085,147 V14A possibly damaging Het
Myo1b T C 1: 51,768,651 K823R probably null Het
Nbea G T 3: 56,037,149 T598K probably damaging Het
Nrcam C A 12: 44,572,300 H877N probably benign Het
Nrxn2 T C 19: 6,531,292 probably null Het
Nwd2 A T 5: 63,800,253 I309F possibly damaging Het
Phyhd1 G A 2: 30,274,724 probably null Het
Pkp2 C T 16: 16,226,069 T229I probably damaging Het
Plagl2 G A 2: 153,232,691 P97S probably benign Het
Plekhh2 C A 17: 84,566,866 N526K probably benign Het
Plin4 A G 17: 56,103,261 L1217P probably benign Het
Polr3e T C 7: 120,927,999 S67P possibly damaging Het
Postn A G 3: 54,385,282 K757E probably benign Het
Prpf39 T A 12: 65,042,813 probably null Het
Ptprg C T 14: 12,166,832 T745I probably damaging Het
Pxylp1 C G 9: 96,825,254 A292P probably damaging Het
Rpl35 G T 2: 39,001,742 D82E possibly damaging Het
Slc9a1 G A 4: 133,422,208 V782I possibly damaging Het
Syn2 T A 6: 115,263,914 M415K possibly damaging Het
Tmem117 A C 15: 95,011,443 I246L probably benign Het
Tmem221 A T 8: 71,558,784 V9E probably damaging Het
Ubxn7 T A 16: 32,372,189 probably null Het
Vmn2r101 G T 17: 19,589,850 M299I possibly damaging Het
Vmn2r103 T A 17: 19,794,082 S379T probably damaging Het
Vmn2r109 T C 17: 20,541,178 N639S probably benign Het
Wdr26 T C 1: 181,203,206 Het
Zfp109 T A 7: 24,228,883 Y367F probably damaging Het
Zfp143 G A 7: 110,086,131 C389Y probably damaging Het
Zfp553 G T 7: 127,236,892 probably null Het
Other mutations in Chek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Chek1 APN 9 36722599 splice site probably null
IGL01061:Chek1 APN 9 36714519 missense possibly damaging 0.70
IGL01322:Chek1 APN 9 36718421 nonsense probably null
IGL01627:Chek1 APN 9 36723895 missense probably damaging 1.00
IGL02379:Chek1 APN 9 36723946 missense probably benign 0.03
IGL03160:Chek1 APN 9 36722645 missense probably damaging 1.00
R0558:Chek1 UTSW 9 36712115 missense possibly damaging 0.72
R1035:Chek1 UTSW 9 36716473 missense probably damaging 1.00
R1466:Chek1 UTSW 9 36725857 missense probably damaging 1.00
R1466:Chek1 UTSW 9 36725857 missense probably damaging 1.00
R1606:Chek1 UTSW 9 36719524 missense probably damaging 1.00
R1627:Chek1 UTSW 9 36714441 missense probably benign
R2152:Chek1 UTSW 9 36723983 missense probably damaging 1.00
R2153:Chek1 UTSW 9 36723983 missense probably damaging 1.00
R2154:Chek1 UTSW 9 36723983 missense probably damaging 1.00
R2270:Chek1 UTSW 9 36719686 missense probably damaging 1.00
R4014:Chek1 UTSW 9 36722754 splice site probably benign
R5285:Chek1 UTSW 9 36714452 missense probably benign 0.00
R5458:Chek1 UTSW 9 36714429 missense probably benign 0.30
R5547:Chek1 UTSW 9 36712104 missense probably benign 0.02
R5819:Chek1 UTSW 9 36710405 missense probably benign 0.01
R5853:Chek1 UTSW 9 36713687 missense probably damaging 1.00
R6353:Chek1 UTSW 9 36723959 missense probably benign 0.01
R7319:Chek1 UTSW 9 36722643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTAAGAAAAGGGCTTAATCTGC -3'
(R):5'- GCATTAAAATTGTGGCCTTTGTGAAG -3'

Sequencing Primer
(F):5'- TTATACAAGTTCAAGACCAGGGTG -3'
(R):5'- GCCTTTGTGAAGCATTAGTGTAAC -3'
Posted On2018-04-02