Incidental Mutation 'R6334:2810021J22Rik'
ID 510715
Institutional Source Beutler Lab
Gene Symbol 2810021J22Rik
Ensembl Gene ENSMUSG00000020491
Gene Name RIKEN cDNA 2810021J22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6334 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 58867216-58883288 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58880114 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 141 (S141T)
Ref Sequence ENSEMBL: ENSMUSP00000073579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073924] [ENSMUST00000132570]
AlphaFold Q8BIB6
Predicted Effect probably benign
Transcript: ENSMUST00000073924
AA Change: S141T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073579
Gene: ENSMUSG00000020491
AA Change: S141T

DomainStartEndE-ValueType
KRAB 8 68 2.38e-30 SMART
ZnF_C2H2 242 264 1.68e1 SMART
ZnF_C2H2 370 392 1.56e-2 SMART
ZnF_C2H2 398 420 1.03e-2 SMART
ZnF_C2H2 426 448 1.38e-3 SMART
ZnF_C2H2 454 476 3.16e-3 SMART
ZnF_C2H2 482 504 1.6e-4 SMART
ZnF_C2H2 510 532 7.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132570
SMART Domains Protein: ENSMUSP00000120692
Gene: ENSMUSG00000020491

DomainStartEndE-ValueType
KRAB 8 64 2.25e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 A G 19: 56,917,976 probably null Het
Aox2 C T 1: 58,307,407 Q567* probably null Het
Aqp4 T A 18: 15,393,591 M278L probably benign Het
Atp23 A C 10: 126,887,669 L188R probably benign Het
B230359F08Rik A G 14: 53,795,942 T103A probably damaging Het
Catsperg1 C T 7: 29,206,357 G215D probably benign Het
Cavin4 T C 4: 48,663,824 V68A possibly damaging Het
Ccl4 T C 11: 83,662,678 S6P unknown Het
Cfap46 T C 7: 139,680,831 E117G probably damaging Het
Chek1 A G 9: 36,714,492 S286P possibly damaging Het
Cntn4 G A 6: 106,344,786 V35I probably benign Het
Cntn4 C A 6: 106,506,192 P236Q probably benign Het
Cyp2d40 C A 15: 82,761,552 G84V probably benign Het
Dnah12 A T 14: 26,706,834 H205L possibly damaging Het
Dock1 G A 7: 134,851,576 V845I probably benign Het
Drg1 T C 11: 3,266,292 K7E possibly damaging Het
Eloa G A 4: 136,009,822 P488S probably damaging Het
Evi5 G A 5: 107,820,521 R187* probably null Het
Fam53a T A 5: 33,600,875 L301F probably damaging Het
Fmnl3 T C 15: 99,337,653 K63E probably damaging Het
Gast C A 11: 100,336,612 Q44K probably benign Het
Gm4788 A G 1: 139,773,924 probably null Het
Gng10 T A 4: 59,035,257 V7E probably benign Het
Gtf3c5 G A 2: 28,570,462 T375I probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hspa14 A T 2: 3,489,072 probably null Het
Kcna3 T C 3: 107,036,424 M1T probably null Het
Kcnj15 T G 16: 95,296,236 L239R probably damaging Het
Klhl2 G T 8: 64,759,808 D232E probably benign Het
Lamb3 A T 1: 193,335,474 I888F probably damaging Het
Lars C A 18: 42,217,486 M919I probably benign Het
Lfng T C 5: 140,612,767 V247A possibly damaging Het
Lrp1b C T 2: 41,789,033 A16T probably benign Het
Mamdc2 A T 19: 23,363,906 I235N probably damaging Het
Map9 T A 3: 82,383,305 L492Q probably damaging Het
Mcpt8 A G 14: 56,085,147 V14A possibly damaging Het
Myo1b T C 1: 51,768,651 K823R probably null Het
Nbea G T 3: 56,037,149 T598K probably damaging Het
Nrcam C A 12: 44,572,300 H877N probably benign Het
Nrxn2 T C 19: 6,531,292 probably null Het
Nwd2 A T 5: 63,800,253 I309F possibly damaging Het
Phyhd1 G A 2: 30,274,724 probably null Het
Pkp2 C T 16: 16,226,069 T229I probably damaging Het
Plagl2 G A 2: 153,232,691 P97S probably benign Het
Plekhh2 C A 17: 84,566,866 N526K probably benign Het
Plin4 A G 17: 56,103,261 L1217P probably benign Het
Polr3e T C 7: 120,927,999 S67P possibly damaging Het
Postn A G 3: 54,385,282 K757E probably benign Het
Prpf39 T A 12: 65,042,813 probably null Het
Ptprg C T 14: 12,166,832 T745I probably damaging Het
Pxylp1 C G 9: 96,825,254 A292P probably damaging Het
Rpl35 G T 2: 39,001,742 D82E possibly damaging Het
Slc9a1 G A 4: 133,422,208 V782I possibly damaging Het
Syn2 T A 6: 115,263,914 M415K possibly damaging Het
Tmem117 A C 15: 95,011,443 I246L probably benign Het
Tmem221 A T 8: 71,558,784 V9E probably damaging Het
Ubxn7 T A 16: 32,372,189 probably null Het
Vmn2r101 G T 17: 19,589,850 M299I possibly damaging Het
Vmn2r103 T A 17: 19,794,082 S379T probably damaging Het
Vmn2r109 T C 17: 20,541,178 N639S probably benign Het
Wdr26 T C 1: 181,203,206 Het
Zfp109 T A 7: 24,228,883 Y367F probably damaging Het
Zfp143 G A 7: 110,086,131 C389Y probably damaging Het
Zfp553 G T 7: 127,236,892 probably null Het
Other mutations in 2810021J22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:2810021J22Rik APN 11 58880612 nonsense probably null
IGL01784:2810021J22Rik APN 11 58880619 missense possibly damaging 0.89
IGL02287:2810021J22Rik APN 11 58880592 missense probably benign 0.00
IGL03281:2810021J22Rik APN 11 58880775 missense probably benign 0.01
H8562:2810021J22Rik UTSW 11 58880891 missense probably damaging 1.00
R0480:2810021J22Rik UTSW 11 58880186 missense probably damaging 0.99
R1148:2810021J22Rik UTSW 11 58876718 missense probably damaging 0.97
R1148:2810021J22Rik UTSW 11 58876718 missense probably damaging 0.97
R1493:2810021J22Rik UTSW 11 58876718 missense probably damaging 0.97
R1565:2810021J22Rik UTSW 11 58880501 missense probably benign 0.00
R1676:2810021J22Rik UTSW 11 58880993 missense possibly damaging 0.70
R2070:2810021J22Rik UTSW 11 58876769 missense probably damaging 0.98
R2071:2810021J22Rik UTSW 11 58876769 missense probably damaging 0.98
R4402:2810021J22Rik UTSW 11 58880194 missense probably benign 0.01
R4541:2810021J22Rik UTSW 11 58878850 missense probably benign 0.16
R4685:2810021J22Rik UTSW 11 58880924 missense probably damaging 0.97
R4765:2810021J22Rik UTSW 11 58881161 missense probably benign 0.09
R4968:2810021J22Rik UTSW 11 58878790 nonsense probably null
R5282:2810021J22Rik UTSW 11 58880340 missense possibly damaging 0.84
R5519:2810021J22Rik UTSW 11 58880097 missense probably benign
R6083:2810021J22Rik UTSW 11 58878851 missense possibly damaging 0.73
R6134:2810021J22Rik UTSW 11 58876793 missense probably damaging 1.00
R7108:2810021J22Rik UTSW 11 58880924 missense probably damaging 0.97
R7288:2810021J22Rik UTSW 11 58880305 missense probably benign 0.03
R7310:2810021J22Rik UTSW 11 58880268 missense possibly damaging 0.89
R7422:2810021J22Rik UTSW 11 58881059 missense probably damaging 1.00
R7829:2810021J22Rik UTSW 11 58879997 missense not run
R8237:2810021J22Rik UTSW 11 58880547 missense probably damaging 1.00
R8303:2810021J22Rik UTSW 11 58880140 missense probably benign 0.00
R9453:2810021J22Rik UTSW 11 58880228 missense probably benign 0.01
Z1177:2810021J22Rik UTSW 11 58880103 missense probably damaging 0.99
Z1186:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Z1187:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Z1188:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Z1189:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Z1190:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Z1191:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Z1192:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAGCCTATGAAGAGTCTG -3'
(R):5'- CACTGTACGCGTCCATACAG -3'

Sequencing Primer
(F):5'- CCTATGAAGAGTCTGAAGGAAGCC -3'
(R):5'- GTCCATACAGTGCGCACATCG -3'
Posted On 2018-04-02