Incidental Mutation 'R6334:Gast'
ID510717
Institutional Source Beutler Lab
Gene Symbol Gast
Ensembl Gene ENSMUSG00000017165
Gene Namegastrin
SynonymsGAS
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6334 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100334407-100336996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100336612 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 44 (Q44K)
Ref Sequence ENSEMBL: ENSMUSP00000017309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017309]
Predicted Effect probably benign
Transcript: ENSMUST00000017309
AA Change: Q44K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000017309
Gene: ENSMUSG00000017165
AA Change: Q44K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
GASTRIN 88 101 5.83e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes the peptide hormone gastrin, which stimulates gastric acid secretion, proliferation, cell migration and angiogenesis, as well as inhibits apoptosis. The encoded preproprotein undergoes proteolytic processing to generate multiple gastrin peptides differing in size. Mice lacking the encoded protein exhibit a decrease in the number of parietal cells, achlorohydria and a decrease in the colonic proliferation. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for targeted null alleles exhibit an absence of gastric acid secretion, alterations in gastric architecture, fasting hypoglycemia with impaired glucagon response, and increased susceptibility to azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,114 S141T probably benign Het
Afap1l2 A G 19: 56,917,976 probably null Het
Aox2 C T 1: 58,307,407 Q567* probably null Het
Aqp4 T A 18: 15,393,591 M278L probably benign Het
Atp23 A C 10: 126,887,669 L188R probably benign Het
B230359F08Rik A G 14: 53,795,942 T103A probably damaging Het
Catsperg1 C T 7: 29,206,357 G215D probably benign Het
Cavin4 T C 4: 48,663,824 V68A possibly damaging Het
Ccl4 T C 11: 83,662,678 S6P unknown Het
Cfap46 T C 7: 139,680,831 E117G probably damaging Het
Chek1 A G 9: 36,714,492 S286P possibly damaging Het
Cntn4 G A 6: 106,344,786 V35I probably benign Het
Cntn4 C A 6: 106,506,192 P236Q probably benign Het
Cyp2d40 C A 15: 82,761,552 G84V probably benign Het
Dnah12 A T 14: 26,706,834 H205L possibly damaging Het
Dock1 G A 7: 134,851,576 V845I probably benign Het
Drg1 T C 11: 3,266,292 K7E possibly damaging Het
Eloa G A 4: 136,009,822 P488S probably damaging Het
Evi5 G A 5: 107,820,521 R187* probably null Het
Fam53a T A 5: 33,600,875 L301F probably damaging Het
Fmnl3 T C 15: 99,337,653 K63E probably damaging Het
Gm4788 A G 1: 139,773,924 probably null Het
Gng10 T A 4: 59,035,257 V7E probably benign Het
Gtf3c5 G A 2: 28,570,462 T375I probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hspa14 A T 2: 3,489,072 probably null Het
Kcna3 T C 3: 107,036,424 M1T probably null Het
Kcnj15 T G 16: 95,296,236 L239R probably damaging Het
Klhl2 G T 8: 64,759,808 D232E probably benign Het
Lamb3 A T 1: 193,335,474 I888F probably damaging Het
Lars C A 18: 42,217,486 M919I probably benign Het
Lfng T C 5: 140,612,767 V247A possibly damaging Het
Lrp1b C T 2: 41,789,033 A16T probably benign Het
Mamdc2 A T 19: 23,363,906 I235N probably damaging Het
Map9 T A 3: 82,383,305 L492Q probably damaging Het
Mcpt8 A G 14: 56,085,147 V14A possibly damaging Het
Myo1b T C 1: 51,768,651 K823R probably null Het
Nbea G T 3: 56,037,149 T598K probably damaging Het
Nrcam C A 12: 44,572,300 H877N probably benign Het
Nrxn2 T C 19: 6,531,292 probably null Het
Nwd2 A T 5: 63,800,253 I309F possibly damaging Het
Phyhd1 G A 2: 30,274,724 probably null Het
Pkp2 C T 16: 16,226,069 T229I probably damaging Het
Plagl2 G A 2: 153,232,691 P97S probably benign Het
Plekhh2 C A 17: 84,566,866 N526K probably benign Het
Plin4 A G 17: 56,103,261 L1217P probably benign Het
Polr3e T C 7: 120,927,999 S67P possibly damaging Het
Postn A G 3: 54,385,282 K757E probably benign Het
Prpf39 T A 12: 65,042,813 probably null Het
Ptprg C T 14: 12,166,832 T745I probably damaging Het
Pxylp1 C G 9: 96,825,254 A292P probably damaging Het
Rpl35 G T 2: 39,001,742 D82E possibly damaging Het
Slc9a1 G A 4: 133,422,208 V782I possibly damaging Het
Syn2 T A 6: 115,263,914 M415K possibly damaging Het
Tmem117 A C 15: 95,011,443 I246L probably benign Het
Tmem221 A T 8: 71,558,784 V9E probably damaging Het
Ubxn7 T A 16: 32,372,189 probably null Het
Vmn2r101 G T 17: 19,589,850 M299I possibly damaging Het
Vmn2r103 T A 17: 19,794,082 S379T probably damaging Het
Vmn2r109 T C 17: 20,541,178 N639S probably benign Het
Wdr26 T C 1: 181,203,206 Het
Zfp109 T A 7: 24,228,883 Y367F probably damaging Het
Zfp143 G A 7: 110,086,131 C389Y probably damaging Het
Zfp553 G T 7: 127,236,892 probably null Het
Other mutations in Gast
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02514:Gast APN 11 100336892 missense probably benign
R1769:Gast UTSW 11 100336858 missense probably damaging 1.00
R3801:Gast UTSW 11 100336810 missense probably damaging 0.99
R3804:Gast UTSW 11 100336810 missense probably damaging 0.99
R4356:Gast UTSW 11 100336547 missense probably damaging 0.99
X0024:Gast UTSW 11 100336663 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCTCTGGGACTATGGAATAGC -3'
(R):5'- CTGCTTCTTGGACAGGTCTG -3'

Sequencing Primer
(F):5'- GGACTATGGAATAGCCCCATCTTG -3'
(R):5'- CTTGGACAGGTCTGAGGAGGTAAC -3'
Posted On2018-04-02