Incidental Mutation 'R6334:Fmnl3'
ID510725
Institutional Source Beutler Lab
Gene Symbol Fmnl3
Ensembl Gene ENSMUSG00000023008
Gene Nameformin-like 3
SynonymsWbp3, 2700073B04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_011711; MGI: 109569  

Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R6334 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99317225-99370482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99337653 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 63 (K63E)
Ref Sequence ENSEMBL: ENSMUSP00000085566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081224] [ENSMUST00000088233] [ENSMUST00000120633]
Predicted Effect probably damaging
Transcript: ENSMUST00000081224
AA Change: K63E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079984
Gene: ENSMUSG00000023008
AA Change: K63E

DomainStartEndE-ValueType
Drf_GBD 26 227 2.99e-88 SMART
Drf_FH3 230 421 6.1e-71 SMART
low complexity region 448 497 N/A INTRINSIC
FH2 510 944 9.85e-141 SMART
low complexity region 960 975 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088233
AA Change: K63E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085566
Gene: ENSMUSG00000023008
AA Change: K63E

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120633
AA Change: K63E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113094
Gene: ENSMUSG00000023008
AA Change: K63E

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
low complexity region 1011 1026 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140368
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a formin homology 2 domain and has high sequence identity to the mouse Wbp3 protein. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,114 S141T probably benign Het
Afap1l2 A G 19: 56,917,976 probably null Het
Aox2 C T 1: 58,307,407 Q567* probably null Het
Aqp4 T A 18: 15,393,591 M278L probably benign Het
Atp23 A C 10: 126,887,669 L188R probably benign Het
B230359F08Rik A G 14: 53,795,942 T103A probably damaging Het
Catsperg1 C T 7: 29,206,357 G215D probably benign Het
Cavin4 T C 4: 48,663,824 V68A possibly damaging Het
Ccl4 T C 11: 83,662,678 S6P unknown Het
Cfap46 T C 7: 139,680,831 E117G probably damaging Het
Chek1 A G 9: 36,714,492 S286P possibly damaging Het
Cntn4 G A 6: 106,344,786 V35I probably benign Het
Cntn4 C A 6: 106,506,192 P236Q probably benign Het
Cyp2d40 C A 15: 82,761,552 G84V probably benign Het
Dnah12 A T 14: 26,706,834 H205L possibly damaging Het
Dock1 G A 7: 134,851,576 V845I probably benign Het
Drg1 T C 11: 3,266,292 K7E possibly damaging Het
Eloa G A 4: 136,009,822 P488S probably damaging Het
Evi5 G A 5: 107,820,521 R187* probably null Het
Fam53a T A 5: 33,600,875 L301F probably damaging Het
Gast C A 11: 100,336,612 Q44K probably benign Het
Gm4788 A G 1: 139,773,924 probably null Het
Gng10 T A 4: 59,035,257 V7E probably benign Het
Gtf3c5 G A 2: 28,570,462 T375I probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hspa14 A T 2: 3,489,072 probably null Het
Kcna3 T C 3: 107,036,424 M1T probably null Het
Kcnj15 T G 16: 95,296,236 L239R probably damaging Het
Klhl2 G T 8: 64,759,808 D232E probably benign Het
Lamb3 A T 1: 193,335,474 I888F probably damaging Het
Lars C A 18: 42,217,486 M919I probably benign Het
Lfng T C 5: 140,612,767 V247A possibly damaging Het
Lrp1b C T 2: 41,789,033 A16T probably benign Het
Mamdc2 A T 19: 23,363,906 I235N probably damaging Het
Map9 T A 3: 82,383,305 L492Q probably damaging Het
Mcpt8 A G 14: 56,085,147 V14A possibly damaging Het
Myo1b T C 1: 51,768,651 K823R probably null Het
Nbea G T 3: 56,037,149 T598K probably damaging Het
Nrcam C A 12: 44,572,300 H877N probably benign Het
Nrxn2 T C 19: 6,531,292 probably null Het
Nwd2 A T 5: 63,800,253 I309F possibly damaging Het
Phyhd1 G A 2: 30,274,724 probably null Het
Pkp2 C T 16: 16,226,069 T229I probably damaging Het
Plagl2 G A 2: 153,232,691 P97S probably benign Het
Plekhh2 C A 17: 84,566,866 N526K probably benign Het
Plin4 A G 17: 56,103,261 L1217P probably benign Het
Polr3e T C 7: 120,927,999 S67P possibly damaging Het
Postn A G 3: 54,385,282 K757E probably benign Het
Prpf39 T A 12: 65,042,813 probably null Het
Ptprg C T 14: 12,166,832 T745I probably damaging Het
Pxylp1 C G 9: 96,825,254 A292P probably damaging Het
Rpl35 G T 2: 39,001,742 D82E possibly damaging Het
Slc9a1 G A 4: 133,422,208 V782I possibly damaging Het
Syn2 T A 6: 115,263,914 M415K possibly damaging Het
Tmem117 A C 15: 95,011,443 I246L probably benign Het
Tmem221 A T 8: 71,558,784 V9E probably damaging Het
Ubxn7 T A 16: 32,372,189 probably null Het
Vmn2r101 G T 17: 19,589,850 M299I possibly damaging Het
Vmn2r103 T A 17: 19,794,082 S379T probably damaging Het
Vmn2r109 T C 17: 20,541,178 N639S probably benign Het
Wdr26 T C 1: 181,203,206 Het
Zfp109 T A 7: 24,228,883 Y367F probably damaging Het
Zfp143 G A 7: 110,086,131 C389Y probably damaging Het
Zfp553 G T 7: 127,236,892 probably null Het
Other mutations in Fmnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00672:Fmnl3 APN 15 99325681 missense probably damaging 1.00
IGL00727:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00754:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00927:Fmnl3 APN 15 99337628 critical splice donor site probably null
IGL02376:Fmnl3 APN 15 99318963 missense possibly damaging 0.51
IGL02607:Fmnl3 APN 15 99324772 missense probably damaging 1.00
IGL03323:Fmnl3 APN 15 99321281 missense probably damaging 1.00
C9142:Fmnl3 UTSW 15 99337627 splice site probably null
PIT4280001:Fmnl3 UTSW 15 99321253 critical splice donor site probably null
R0003:Fmnl3 UTSW 15 99321132 missense probably damaging 0.99
R0003:Fmnl3 UTSW 15 99321132 missense probably damaging 0.99
R0116:Fmnl3 UTSW 15 99322738 splice site probably benign
R0117:Fmnl3 UTSW 15 99322738 splice site probably benign
R0137:Fmnl3 UTSW 15 99322738 splice site probably benign
R0138:Fmnl3 UTSW 15 99322738 splice site probably benign
R0701:Fmnl3 UTSW 15 99321307 missense probably damaging 0.99
R2338:Fmnl3 UTSW 15 99370227 missense probably benign 0.01
R3729:Fmnl3 UTSW 15 99321864 missense probably damaging 0.99
R4707:Fmnl3 UTSW 15 99323481 missense probably benign 0.00
R5346:Fmnl3 UTSW 15 99331990 missense probably damaging 1.00
R5655:Fmnl3 UTSW 15 99321862 missense probably damaging 0.99
R5916:Fmnl3 UTSW 15 99321828 missense probably damaging 0.99
R5951:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R5954:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R5957:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R6891:Fmnl3 UTSW 15 99325873 missense probably damaging 1.00
R7182:Fmnl3 UTSW 15 99321782 missense probably damaging 0.99
R7423:Fmnl3 UTSW 15 99329400 missense probably damaging 0.99
X0009:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0010:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0011:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0012:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0014:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0017:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0021:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0023:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0023:Fmnl3 UTSW 15 99325284 missense probably damaging 1.00
X0028:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0033:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0060:Fmnl3 UTSW 15 99320038 missense possibly damaging 0.69
X0064:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0067:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGCACCTCCTGATCTTG -3'
(R):5'- TTGTTCAACCAAGCTTGACAG -3'

Sequencing Primer
(F):5'- TGATCTTGCCAAGCTCATACCAAG -3'
(R):5'- TCAACCAAGCTTGACAGTGGGG -3'
Posted On2018-04-02