Incidental Mutation 'R6334:Vmn2r103'
ID 510729
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission 044488-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R6334 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19993625-20032798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20014344 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 379 (S379T)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably damaging
Transcript: ENSMUST00000172203
AA Change: S379T

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: S379T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,770,940 (GRCm39) S141T probably benign Het
Afap1l2 A G 19: 56,906,408 (GRCm39) probably null Het
Aox1 C T 1: 58,346,566 (GRCm39) Q567* probably null Het
Aqp4 T A 18: 15,526,648 (GRCm39) M278L probably benign Het
Atp23 A C 10: 126,723,538 (GRCm39) L188R probably benign Het
Catsperg1 C T 7: 28,905,782 (GRCm39) G215D probably benign Het
Cavin4 T C 4: 48,663,824 (GRCm39) V68A possibly damaging Het
Ccl4 T C 11: 83,553,504 (GRCm39) S6P unknown Het
Cfap46 T C 7: 139,260,747 (GRCm39) E117G probably damaging Het
Cfhr4 A G 1: 139,701,662 (GRCm39) probably null Het
Chek1 A G 9: 36,625,788 (GRCm39) S286P possibly damaging Het
Cntn4 G A 6: 106,321,747 (GRCm39) V35I probably benign Het
Cntn4 C A 6: 106,483,153 (GRCm39) P236Q probably benign Het
Cyp2d40 C A 15: 82,645,753 (GRCm39) G84V probably benign Het
Dnah12 A T 14: 26,427,989 (GRCm39) H205L possibly damaging Het
Dock1 G A 7: 134,453,305 (GRCm39) V845I probably benign Het
Drg1 T C 11: 3,216,292 (GRCm39) K7E possibly damaging Het
Eloa G A 4: 135,737,133 (GRCm39) P488S probably damaging Het
Evi5 G A 5: 107,968,387 (GRCm39) R187* probably null Het
Fam53a T A 5: 33,758,219 (GRCm39) L301F probably damaging Het
Fmnl3 T C 15: 99,235,534 (GRCm39) K63E probably damaging Het
Gast C A 11: 100,227,438 (GRCm39) Q44K probably benign Het
Gng10 T A 4: 59,035,257 (GRCm39) V7E probably benign Het
Gtf3c5 G A 2: 28,460,474 (GRCm39) T375I probably benign Het
Haus5 C T 7: 30,358,401 (GRCm39) W298* probably null Het
Hspa14 A T 2: 3,490,109 (GRCm39) probably null Het
Kcna3 T C 3: 106,943,740 (GRCm39) M1T probably null Het
Kcnj15 T G 16: 95,097,095 (GRCm39) L239R probably damaging Het
Klhl2 G T 8: 65,212,842 (GRCm39) D232E probably benign Het
Lamb3 A T 1: 193,017,782 (GRCm39) I888F probably damaging Het
Lars1 C A 18: 42,350,551 (GRCm39) M919I probably benign Het
Lfng T C 5: 140,598,522 (GRCm39) V247A possibly damaging Het
Lrp1b C T 2: 41,679,045 (GRCm39) A16T probably benign Het
Mamdc2 A T 19: 23,341,270 (GRCm39) I235N probably damaging Het
Map9 T A 3: 82,290,612 (GRCm39) L492Q probably damaging Het
Mcpt8 A G 14: 56,322,604 (GRCm39) V14A possibly damaging Het
Myo1b T C 1: 51,807,810 (GRCm39) K823R probably null Het
Nbea G T 3: 55,944,570 (GRCm39) T598K probably damaging Het
Nrcam C A 12: 44,619,083 (GRCm39) H877N probably benign Het
Nrxn2 T C 19: 6,581,322 (GRCm39) probably null Het
Nwd2 A T 5: 63,957,596 (GRCm39) I309F possibly damaging Het
Phyhd1 G A 2: 30,164,736 (GRCm39) probably null Het
Pkp2 C T 16: 16,043,933 (GRCm39) T229I probably damaging Het
Plagl2 G A 2: 153,074,611 (GRCm39) P97S probably benign Het
Plekhh2 C A 17: 84,874,294 (GRCm39) N526K probably benign Het
Plin4 A G 17: 56,410,261 (GRCm39) L1217P probably benign Het
Polr3e T C 7: 120,527,222 (GRCm39) S67P possibly damaging Het
Postn A G 3: 54,292,703 (GRCm39) K757E probably benign Het
Prpf39 T A 12: 65,089,587 (GRCm39) probably null Het
Ptprg C T 14: 12,166,832 (GRCm38) T745I probably damaging Het
Pxylp1 C G 9: 96,707,307 (GRCm39) A292P probably damaging Het
Rpl35 G T 2: 38,891,754 (GRCm39) D82E possibly damaging Het
Slc9a1 G A 4: 133,149,519 (GRCm39) V782I possibly damaging Het
Syn2 T A 6: 115,240,875 (GRCm39) M415K possibly damaging Het
Tmem117 A C 15: 94,909,324 (GRCm39) I246L probably benign Het
Tmem221 A T 8: 72,011,428 (GRCm39) V9E probably damaging Het
Trav13-5 A G 14: 54,033,399 (GRCm39) T103A probably damaging Het
Ubxn7 T A 16: 32,191,007 (GRCm39) probably null Het
Vmn2r101 G T 17: 19,810,112 (GRCm39) M299I possibly damaging Het
Vmn2r109 T C 17: 20,761,440 (GRCm39) N639S probably benign Het
Wdr26 T C 1: 181,030,771 (GRCm39) Het
Zfp109 T A 7: 23,928,308 (GRCm39) Y367F probably damaging Het
Zfp143 G A 7: 109,685,338 (GRCm39) C389Y probably damaging Het
Zfp553 G T 7: 126,836,064 (GRCm39) probably null Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 20,013,364 (GRCm39) missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 20,015,227 (GRCm39) missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 20,013,259 (GRCm39) missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 20,013,229 (GRCm39) missense probably benign
IGL01404:Vmn2r103 APN 17 20,032,696 (GRCm39) missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 20,014,330 (GRCm39) missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 20,019,470 (GRCm39) missense probably benign
IGL02251:Vmn2r103 APN 17 20,014,231 (GRCm39) missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19,993,631 (GRCm39) missense probably benign
IGL02555:Vmn2r103 APN 17 20,031,873 (GRCm39) missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 20,014,389 (GRCm39) missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 20,014,218 (GRCm39) missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 20,032,510 (GRCm39) missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19,993,782 (GRCm39) missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 20,032,241 (GRCm39) missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 20,031,903 (GRCm39) missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 20,013,726 (GRCm39) missense probably benign 0.12
R0375:Vmn2r103 UTSW 17 20,013,121 (GRCm39) missense probably benign 0.06
R0755:Vmn2r103 UTSW 17 19,993,830 (GRCm39) missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 20,014,189 (GRCm39) missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 20,014,509 (GRCm39) missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 20,013,230 (GRCm39) missense probably benign
R1488:Vmn2r103 UTSW 17 20,013,922 (GRCm39) missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19,993,662 (GRCm39) missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 20,014,496 (GRCm39) missense probably benign
R1928:Vmn2r103 UTSW 17 20,032,029 (GRCm39) missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 20,032,562 (GRCm39) missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 20,014,056 (GRCm39) missense probably benign
R2219:Vmn2r103 UTSW 17 20,013,909 (GRCm39) missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19,993,793 (GRCm39) missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 20,013,862 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 20,032,411 (GRCm39) missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 20,014,495 (GRCm39) missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 20,032,077 (GRCm39) missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 20,032,031 (GRCm39) missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 20,032,433 (GRCm39) missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 20,013,904 (GRCm39) missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 20,013,251 (GRCm39) missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 20,015,201 (GRCm39) missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 20,032,715 (GRCm39) missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 20,014,478 (GRCm39) nonsense probably null
R6114:Vmn2r103 UTSW 17 20,032,587 (GRCm39) missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 20,032,406 (GRCm39) missense probably benign
R6292:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R6501:Vmn2r103 UTSW 17 20,032,166 (GRCm39) missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 20,032,239 (GRCm39) missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 20,013,739 (GRCm39) missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 20,032,314 (GRCm39) missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 20,014,476 (GRCm39) missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 20,013,385 (GRCm39) missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 20,019,511 (GRCm39) missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 20,013,759 (GRCm39) missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 20,032,058 (GRCm39) missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 20,032,205 (GRCm39) missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 20,032,646 (GRCm39) missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 20,032,158 (GRCm39) missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 20,031,921 (GRCm39) missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 20,014,027 (GRCm39) missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 20,019,525 (GRCm39) nonsense probably null
R9743:Vmn2r103 UTSW 17 20,032,475 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 20,015,309 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACATCATGTTATTGACAGAGCTGAC -3'
(R):5'- TTATTACCTGCCATGGAAAGAACAC -3'

Sequencing Primer
(F):5'- GTTAGACTCATTCCATGGAAGCC -3'
(R):5'- TGGAAAGAACACCATCCCTTCTC -3'
Posted On 2018-04-02