Incidental Mutation 'R6334:Plin4'
ID510731
Institutional Source Beutler Lab
Gene Symbol Plin4
Ensembl Gene ENSMUSG00000002831
Gene Nameperilipin 4
SynonymsS3-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6334 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56100591-56109803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56103261 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1217 (L1217P)
Ref Sequence ENSEMBL: ENSMUSP00000139859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002908] [ENSMUST00000002911] [ENSMUST00000190703] [ENSMUST00000225843] [ENSMUST00000226053]
Predicted Effect probably benign
Transcript: ENSMUST00000002908
AA Change: L1217P

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000002908
Gene: ENSMUSG00000002831
AA Change: L1217P

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
low complexity region 1124 1136 N/A INTRINSIC
Pfam:Perilipin 1144 1385 2.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002911
SMART Domains Protein: ENSMUSP00000002911
Gene: ENSMUSG00000002833

DomainStartEndE-ValueType
PWWP 5 62 1.78e-19 SMART
low complexity region 90 109 N/A INTRINSIC
low complexity region 127 136 N/A INTRINSIC
low complexity region 137 153 N/A INTRINSIC
low complexity region 163 175 N/A INTRINSIC
low complexity region 181 196 N/A INTRINSIC
low complexity region 212 243 N/A INTRINSIC
low complexity region 252 272 N/A INTRINSIC
low complexity region 273 300 N/A INTRINSIC
low complexity region 301 311 N/A INTRINSIC
coiled coil region 321 364 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
Pfam:LEDGF 468 569 2.8e-31 PFAM
internal_repeat_1 575 644 2.5e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000190703
AA Change: L1217P

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139859
Gene: ENSMUSG00000002831
AA Change: L1217P

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
Pfam:Perilipin 1110 1385 1.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225731
Predicted Effect probably benign
Transcript: ENSMUST00000225843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226035
Predicted Effect probably benign
Transcript: ENSMUST00000226053
Meta Mutation Damage Score 0.2751 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the perilipin family, such as PLIN4, coat intracellular lipid storage droplets (Wolins et al., 2003 [PubMed 12840023]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased triglyceride in the heart and protection from cardiac steatosis induced by prolonged fasting, feeding or genetic obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,114 S141T probably benign Het
Afap1l2 A G 19: 56,917,976 probably null Het
Aox2 C T 1: 58,307,407 Q567* probably null Het
Aqp4 T A 18: 15,393,591 M278L probably benign Het
Atp23 A C 10: 126,887,669 L188R probably benign Het
B230359F08Rik A G 14: 53,795,942 T103A probably damaging Het
Catsperg1 C T 7: 29,206,357 G215D probably benign Het
Cavin4 T C 4: 48,663,824 V68A possibly damaging Het
Ccl4 T C 11: 83,662,678 S6P unknown Het
Cfap46 T C 7: 139,680,831 E117G probably damaging Het
Chek1 A G 9: 36,714,492 S286P possibly damaging Het
Cntn4 G A 6: 106,344,786 V35I probably benign Het
Cntn4 C A 6: 106,506,192 P236Q probably benign Het
Cyp2d40 C A 15: 82,761,552 G84V probably benign Het
Dnah12 A T 14: 26,706,834 H205L possibly damaging Het
Dock1 G A 7: 134,851,576 V845I probably benign Het
Drg1 T C 11: 3,266,292 K7E possibly damaging Het
Eloa G A 4: 136,009,822 P488S probably damaging Het
Evi5 G A 5: 107,820,521 R187* probably null Het
Fam53a T A 5: 33,600,875 L301F probably damaging Het
Fmnl3 T C 15: 99,337,653 K63E probably damaging Het
Gast C A 11: 100,336,612 Q44K probably benign Het
Gm4788 A G 1: 139,773,924 probably null Het
Gng10 T A 4: 59,035,257 V7E probably benign Het
Gtf3c5 G A 2: 28,570,462 T375I probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hspa14 A T 2: 3,489,072 probably null Het
Kcna3 T C 3: 107,036,424 M1T probably null Het
Kcnj15 T G 16: 95,296,236 L239R probably damaging Het
Klhl2 G T 8: 64,759,808 D232E probably benign Het
Lamb3 A T 1: 193,335,474 I888F probably damaging Het
Lars C A 18: 42,217,486 M919I probably benign Het
Lfng T C 5: 140,612,767 V247A possibly damaging Het
Lrp1b C T 2: 41,789,033 A16T probably benign Het
Mamdc2 A T 19: 23,363,906 I235N probably damaging Het
Map9 T A 3: 82,383,305 L492Q probably damaging Het
Mcpt8 A G 14: 56,085,147 V14A possibly damaging Het
Myo1b T C 1: 51,768,651 K823R probably null Het
Nbea G T 3: 56,037,149 T598K probably damaging Het
Nrcam C A 12: 44,572,300 H877N probably benign Het
Nrxn2 T C 19: 6,531,292 probably null Het
Nwd2 A T 5: 63,800,253 I309F possibly damaging Het
Phyhd1 G A 2: 30,274,724 probably null Het
Pkp2 C T 16: 16,226,069 T229I probably damaging Het
Plagl2 G A 2: 153,232,691 P97S probably benign Het
Plekhh2 C A 17: 84,566,866 N526K probably benign Het
Polr3e T C 7: 120,927,999 S67P possibly damaging Het
Postn A G 3: 54,385,282 K757E probably benign Het
Prpf39 T A 12: 65,042,813 probably null Het
Ptprg C T 14: 12,166,832 T745I probably damaging Het
Pxylp1 C G 9: 96,825,254 A292P probably damaging Het
Rpl35 G T 2: 39,001,742 D82E possibly damaging Het
Slc9a1 G A 4: 133,422,208 V782I possibly damaging Het
Syn2 T A 6: 115,263,914 M415K possibly damaging Het
Tmem117 A C 15: 95,011,443 I246L probably benign Het
Tmem221 A T 8: 71,558,784 V9E probably damaging Het
Ubxn7 T A 16: 32,372,189 probably null Het
Vmn2r101 G T 17: 19,589,850 M299I possibly damaging Het
Vmn2r103 T A 17: 19,794,082 S379T probably damaging Het
Vmn2r109 T C 17: 20,541,178 N639S probably benign Het
Wdr26 T C 1: 181,203,206 Het
Zfp109 T A 7: 24,228,883 Y367F probably damaging Het
Zfp143 G A 7: 110,086,131 C389Y probably damaging Het
Zfp553 G T 7: 127,236,892 probably null Het
Other mutations in Plin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Plin4 APN 17 56107362 missense probably damaging 0.98
IGL02121:Plin4 APN 17 56102131 missense probably damaging 0.98
IGL02254:Plin4 APN 17 56104733 missense probably damaging 0.98
IGL02539:Plin4 APN 17 56106680 missense probably damaging 1.00
IGL02892:Plin4 APN 17 56105108 missense probably damaging 1.00
IGL03051:Plin4 APN 17 56105417 missense possibly damaging 0.91
IGL03258:Plin4 APN 17 56104371 missense probably benign 0.05
PIT4519001:Plin4 UTSW 17 56103828 missense probably benign 0.23
R0211:Plin4 UTSW 17 56102242 missense probably damaging 1.00
R0365:Plin4 UTSW 17 56104667 missense possibly damaging 0.93
R0545:Plin4 UTSW 17 56106567 missense probably damaging 1.00
R0551:Plin4 UTSW 17 56106756 missense probably benign 0.03
R0862:Plin4 UTSW 17 56103966 missense probably benign 0.00
R0864:Plin4 UTSW 17 56103966 missense probably benign 0.00
R1260:Plin4 UTSW 17 56104348 nonsense probably null
R1650:Plin4 UTSW 17 56104931 missense probably damaging 0.99
R1688:Plin4 UTSW 17 56109363 missense possibly damaging 0.61
R1725:Plin4 UTSW 17 56106473 missense probably damaging 1.00
R1803:Plin4 UTSW 17 56104931 missense probably damaging 0.99
R1834:Plin4 UTSW 17 56103522 missense probably damaging 0.97
R1953:Plin4 UTSW 17 56103849 missense possibly damaging 0.49
R2860:Plin4 UTSW 17 56106668 missense probably damaging 0.98
R2861:Plin4 UTSW 17 56106668 missense probably damaging 0.98
R2915:Plin4 UTSW 17 56104389 missense probably damaging 0.98
R3438:Plin4 UTSW 17 56107193 missense probably benign 0.26
R3622:Plin4 UTSW 17 56104112 missense possibly damaging 0.92
R3932:Plin4 UTSW 17 56106704 missense probably benign 0.01
R4116:Plin4 UTSW 17 56102113 missense probably benign 0.30
R4201:Plin4 UTSW 17 56104338 missense probably damaging 1.00
R4529:Plin4 UTSW 17 56104274 missense probably damaging 1.00
R4610:Plin4 UTSW 17 56105418 missense probably benign 0.08
R4692:Plin4 UTSW 17 56103762 missense probably damaging 1.00
R4693:Plin4 UTSW 17 56103762 missense probably damaging 1.00
R4718:Plin4 UTSW 17 56106981 missense possibly damaging 0.46
R5283:Plin4 UTSW 17 56106777 missense probably benign 0.00
R5304:Plin4 UTSW 17 56106132 missense probably benign 0.00
R5333:Plin4 UTSW 17 56104970 missense probably benign 0.31
R5484:Plin4 UTSW 17 56104932 missense possibly damaging 0.90
R5569:Plin4 UTSW 17 56102147 missense probably benign 0.02
R5765:Plin4 UTSW 17 56102470 missense possibly damaging 0.68
R5776:Plin4 UTSW 17 56104983 missense probably damaging 0.99
R5828:Plin4 UTSW 17 56107064 missense probably damaging 0.99
R5932:Plin4 UTSW 17 56106356 missense possibly damaging 0.92
R5988:Plin4 UTSW 17 56109567 missense probably benign 0.03
R6053:Plin4 UTSW 17 56108618 missense probably benign 0.01
R6264:Plin4 UTSW 17 56104787 missense possibly damaging 0.90
R6415:Plin4 UTSW 17 56103264 missense probably damaging 1.00
R7030:Plin4 UTSW 17 56103969 missense probably damaging 1.00
R7302:Plin4 UTSW 17 56102330 missense probably benign 0.00
R7342:Plin4 UTSW 17 56104608 missense probably benign 0.01
R7352:Plin4 UTSW 17 56104427 missense probably benign 0.16
R7354:Plin4 UTSW 17 56104427 missense probably benign 0.16
R7505:Plin4 UTSW 17 56109357 missense possibly damaging 0.56
R7540:Plin4 UTSW 17 56104883 missense probably damaging 0.96
R7570:Plin4 UTSW 17 56106776 missense probably benign 0.00
R7685:Plin4 UTSW 17 56102413 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGCATGCAGGTGGCTTAG -3'
(R):5'- TCAGCCCATGACAACTGAGG -3'

Sequencing Primer
(F):5'- CTAGTGACCAGTTGGAGGAATCC -3'
(R):5'- GAACAAGGTGAGTGCCTCTGC -3'
Posted On2018-04-02