Incidental Mutation 'R6334:Aqp4'
ID510733
Institutional Source Beutler Lab
Gene Symbol Aqp4
Ensembl Gene ENSMUSG00000024411
Gene Nameaquaporin 4
Synonymsaquaporin-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6334 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location15389394-15403684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15393591 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 278 (M278L)
Ref Sequence ENSEMBL: ENSMUSP00000078088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079081]
Predicted Effect probably benign
Transcript: ENSMUST00000079081
AA Change: M278L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078088
Gene: ENSMUSG00000024411
AA Change: M278L

DomainStartEndE-ValueType
Pfam:MIP 29 248 8.7e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit decreased urine osmolality associated with reduced water permeability in inner medullary collecting ducts, increased survival rates and reduced brain edema after acute water intoxication and ischemic stroke, aswell as significant hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,114 S141T probably benign Het
Afap1l2 A G 19: 56,917,976 probably null Het
Aox2 C T 1: 58,307,407 Q567* probably null Het
Atp23 A C 10: 126,887,669 L188R probably benign Het
B230359F08Rik A G 14: 53,795,942 T103A probably damaging Het
Catsperg1 C T 7: 29,206,357 G215D probably benign Het
Cavin4 T C 4: 48,663,824 V68A possibly damaging Het
Ccl4 T C 11: 83,662,678 S6P unknown Het
Cfap46 T C 7: 139,680,831 E117G probably damaging Het
Chek1 A G 9: 36,714,492 S286P possibly damaging Het
Cntn4 G A 6: 106,344,786 V35I probably benign Het
Cntn4 C A 6: 106,506,192 P236Q probably benign Het
Cyp2d40 C A 15: 82,761,552 G84V probably benign Het
Dnah12 A T 14: 26,706,834 H205L possibly damaging Het
Dock1 G A 7: 134,851,576 V845I probably benign Het
Drg1 T C 11: 3,266,292 K7E possibly damaging Het
Eloa G A 4: 136,009,822 P488S probably damaging Het
Evi5 G A 5: 107,820,521 R187* probably null Het
Fam53a T A 5: 33,600,875 L301F probably damaging Het
Fmnl3 T C 15: 99,337,653 K63E probably damaging Het
Gast C A 11: 100,336,612 Q44K probably benign Het
Gm4788 A G 1: 139,773,924 probably null Het
Gng10 T A 4: 59,035,257 V7E probably benign Het
Gtf3c5 G A 2: 28,570,462 T375I probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hspa14 A T 2: 3,489,072 probably null Het
Kcna3 T C 3: 107,036,424 M1T probably null Het
Kcnj15 T G 16: 95,296,236 L239R probably damaging Het
Klhl2 G T 8: 64,759,808 D232E probably benign Het
Lamb3 A T 1: 193,335,474 I888F probably damaging Het
Lars C A 18: 42,217,486 M919I probably benign Het
Lfng T C 5: 140,612,767 V247A possibly damaging Het
Lrp1b C T 2: 41,789,033 A16T probably benign Het
Mamdc2 A T 19: 23,363,906 I235N probably damaging Het
Map9 T A 3: 82,383,305 L492Q probably damaging Het
Mcpt8 A G 14: 56,085,147 V14A possibly damaging Het
Myo1b T C 1: 51,768,651 K823R probably null Het
Nbea G T 3: 56,037,149 T598K probably damaging Het
Nrcam C A 12: 44,572,300 H877N probably benign Het
Nrxn2 T C 19: 6,531,292 probably null Het
Nwd2 A T 5: 63,800,253 I309F possibly damaging Het
Phyhd1 G A 2: 30,274,724 probably null Het
Pkp2 C T 16: 16,226,069 T229I probably damaging Het
Plagl2 G A 2: 153,232,691 P97S probably benign Het
Plekhh2 C A 17: 84,566,866 N526K probably benign Het
Plin4 A G 17: 56,103,261 L1217P probably benign Het
Polr3e T C 7: 120,927,999 S67P possibly damaging Het
Postn A G 3: 54,385,282 K757E probably benign Het
Prpf39 T A 12: 65,042,813 probably null Het
Ptprg C T 14: 12,166,832 T745I probably damaging Het
Pxylp1 C G 9: 96,825,254 A292P probably damaging Het
Rpl35 G T 2: 39,001,742 D82E possibly damaging Het
Slc9a1 G A 4: 133,422,208 V782I possibly damaging Het
Syn2 T A 6: 115,263,914 M415K possibly damaging Het
Tmem117 A C 15: 95,011,443 I246L probably benign Het
Tmem221 A T 8: 71,558,784 V9E probably damaging Het
Ubxn7 T A 16: 32,372,189 probably null Het
Vmn2r101 G T 17: 19,589,850 M299I possibly damaging Het
Vmn2r103 T A 17: 19,794,082 S379T probably damaging Het
Vmn2r109 T C 17: 20,541,178 N639S probably benign Het
Wdr26 T C 1: 181,203,206 Het
Zfp109 T A 7: 24,228,883 Y367F probably damaging Het
Zfp143 G A 7: 110,086,131 C389Y probably damaging Het
Zfp553 G T 7: 127,236,892 probably null Het
Other mutations in Aqp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Aqp4 APN 18 15393599 missense probably benign 0.01
IGL01700:Aqp4 APN 18 15399865 missense probably benign 0.44
IGL02409:Aqp4 APN 18 15399725 missense probably benign 0.02
IGL02812:Aqp4 APN 18 15397575 splice site probably null
IGL03157:Aqp4 APN 18 15399980 missense probably benign 0.18
IGL03196:Aqp4 APN 18 15393509 missense probably benign 0.19
R0358:Aqp4 UTSW 18 15398245 missense probably benign
R1061:Aqp4 UTSW 18 15398191 missense probably damaging 1.00
R1981:Aqp4 UTSW 18 15393551 missense probably damaging 0.98
R1982:Aqp4 UTSW 18 15393551 missense probably damaging 0.98
R2274:Aqp4 UTSW 18 15393480 missense probably benign
R3033:Aqp4 UTSW 18 15393560 missense possibly damaging 0.80
R4608:Aqp4 UTSW 18 15398126 missense probably benign 0.25
R4817:Aqp4 UTSW 18 15399758 missense probably damaging 1.00
R4882:Aqp4 UTSW 18 15398254 missense possibly damaging 0.73
R5870:Aqp4 UTSW 18 15399889 missense probably damaging 1.00
R6235:Aqp4 UTSW 18 15398113 missense probably damaging 1.00
R6856:Aqp4 UTSW 18 15399896 missense possibly damaging 0.88
R7753:Aqp4 UTSW 18 15399976 missense probably benign 0.00
R7839:Aqp4 UTSW 18 15399680 missense possibly damaging 0.51
R7922:Aqp4 UTSW 18 15399680 missense possibly damaging 0.51
T0970:Aqp4 UTSW 18 15399883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAATCTGAGGCCAGGTCTAG -3'
(R):5'- ATGCATAGGTTGTCCACTGAGAC -3'

Sequencing Primer
(F):5'- CCAGGTCTAGGGAGTCTCTTC -3'
(R):5'- ATAGGTTGTCCACTGAGACACTTTTC -3'
Posted On2018-04-02