Mutagenetix > Incidental Mutations

Incidental Mutation 'R6334:Nrxn2'

510735

Institutional Source

Beutler Lab

Gene Symbol

Nrxn2

Ensembl Gene

ENSMUSG00000033768

Gene Name

neurexin II

Synonyms

6430591O13Rik, neurexin II beta, neurexin II alpha

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6334 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6418731-6544169 bp(+) (GRCm38)

Type of Mutation

unclassified (4553 bp from exon)

DNA Base Change (assembly)

T to C at 6531292 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000109078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077182] [ENSMUST00000113451] [ENSMUST00000113458] [ENSMUST00000113459] [ENSMUST00000113461] [ENSMUST00000113462] [ENSMUST00000137166]

Predicted Effect

probably benign
Transcript: ENSMUST00000077182

SMART Domains

Protein: ENSMUSP00000076424
Gene: ENSMUSG00000033768

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
LamG	49	187	1.67e-33	SMART
EGF	205	242	1.73e1	SMART
low complexity region	268	276	N/A	INTRINSIC
LamG	310	444	1.18e-33	SMART
LamG	498	651	1.51e-40	SMART
EGF	678	712	8.91e-3	SMART
LamG	737	875	4.91e-22	SMART
LamG	923	1059	1.08e-41	SMART
EGF	1084	1118	1.91e1	SMART
LamG	1146	1303	4.48e-16	SMART
low complexity region	1332	1362	N/A	INTRINSIC
low complexity region	1430	1445	N/A	INTRINSIC
4.1m	1448	1466	3.75e-4	SMART
low complexity region	1480	1499	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000113451

SMART Domains

Protein: ENSMUSP00000109078
Gene: ENSMUSG00000061742

Domain	Start	End	E-Value	Type
Pfam:Sugar_tr	95	525	2e-26	PFAM
Pfam:MFS_1	128	484	7.5e-26	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113458
AA Change: I376T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000109085
Gene: ENSMUSG00000033768
AA Change: I376T

Domain	Start	End	E-Value	Type
signal peptide	1	46	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
LamG	111	268	4.48e-16	SMART
low complexity region	297	327	N/A	INTRINSIC
low complexity region	383	404	N/A	INTRINSIC
low complexity region	587	602	N/A	INTRINSIC
4.1m	605	623	3.75e-4	SMART
low complexity region	637	656	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113459

SMART Domains

Protein: ENSMUSP00000109086
Gene: ENSMUSG00000033768

Domain	Start	End	E-Value	Type
signal peptide	1	46	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
LamG	111	238	1.26e-19	SMART
low complexity region	267	297	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113461
AA Change: I1356T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000109088
Gene: ENSMUSG00000033768
AA Change: I1356T

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
LamG	49	187	1.67e-33	SMART
EGF	205	242	1.73e1	SMART
LamG	286	428	8.4e-30	SMART
LamG	482	635	1.51e-40	SMART
EGF	662	696	8.91e-3	SMART
LamG	721	850	2.36e-24	SMART
LamG	898	1034	1.08e-41	SMART
EGF	1059	1093	1.91e1	SMART
LamG	1121	1248	1.26e-19	SMART
low complexity region	1277	1307	N/A	INTRINSIC
low complexity region	1363	1384	N/A	INTRINSIC
low complexity region	1567	1582	N/A	INTRINSIC
4.1m	1585	1603	3.75e-4	SMART
low complexity region	1617	1636	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113462
AA Change: I1419T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000109089
Gene: ENSMUSG00000033768
AA Change: I1419T

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
LamG	49	187	1.67e-33	SMART
EGF	205	242	1.73e1	SMART
low complexity region	268	276	N/A	INTRINSIC
LamG	310	452	8.4e-30	SMART
LamG	506	659	1.51e-40	SMART
EGF	686	720	8.91e-3	SMART
LamG	745	883	4.91e-22	SMART
LamG	931	1067	1.08e-41	SMART
EGF	1092	1126	1.91e1	SMART
LamG	1154	1311	4.48e-16	SMART
low complexity region	1340	1370	N/A	INTRINSIC
low complexity region	1426	1447	N/A	INTRINSIC
low complexity region	1630	1645	N/A	INTRINSIC
4.1m	1648	1666	3.75e-4	SMART
low complexity region	1680	1699	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129698

Predicted Effect

probably benign
Transcript: ENSMUST00000137166
AA Change: I1426T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000119762
Gene: ENSMUSG00000033768
AA Change: I1426T

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
LamG	49	187	1.67e-33	SMART
EGF	205	242	1.73e1	SMART
low complexity region	268	276	N/A	INTRINSIC
LamG	310	459	8.87e-29	SMART
LamG	513	666	1.51e-40	SMART
EGF	693	727	8.91e-3	SMART
LamG	752	890	4.91e-22	SMART
LamG	938	1074	1.08e-41	SMART
EGF	1099	1133	1.91e1	SMART
LamG	1161	1318	4.48e-16	SMART
low complexity region	1347	1377	N/A	INTRINSIC
low complexity region	1433	1454	N/A	INTRINSIC
low complexity region	1637	1652	N/A	INTRINSIC
4.1m	1655	1673	3.75e-4	SMART
low complexity region	1687	1706	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137184

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149574

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154580

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin gene family. The products of these genes function as cell adhesion molecules and receptors in the vertebrate nervous system. These genes utilize two promoters. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms while a smaller number of transcripts are produced from the downstream promoter and encode beta-neuresin isoforms. The alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. Alternative splicing and the use of alternative promoters may generate thousands of transcript variants (PMID: 12036300, PMID: 11944992).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are generally non-viable; surviving homozygotes show a 30-40% decrease in body weight and their inhibitory postsynaptic currents (IPSCs) are decreased in cortical slice cultures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	T	A	11: 58,880,114	S141T	probably benign	Het
Afap1l2	A	G	19: 56,917,976		probably null	Het
Aox2	C	T	1: 58,307,407	Q567*	probably null	Het
Aqp4	T	A	18: 15,393,591	M278L	probably benign	Het
Atp23	A	C	10: 126,887,669	L188R	probably benign	Het
B230359F08Rik	A	G	14: 53,795,942	T103A	probably damaging	Het
Catsperg1	C	T	7: 29,206,357	G215D	probably benign	Het
Cavin4	T	C	4: 48,663,824	V68A	possibly damaging	Het
Ccl4	T	C	11: 83,662,678	S6P	unknown	Het
Cfap46	T	C	7: 139,680,831	E117G	probably damaging	Het
Chek1	A	G	9: 36,714,492	S286P	possibly damaging	Het
Cntn4	G	A	6: 106,344,786	V35I	probably benign	Het
Cntn4	C	A	6: 106,506,192	P236Q	probably benign	Het
Cyp2d40	C	A	15: 82,761,552	G84V	probably benign	Het
Dnah12	A	T	14: 26,706,834	H205L	possibly damaging	Het
Dock1	G	A	7: 134,851,576	V845I	probably benign	Het
Drg1	T	C	11: 3,266,292	K7E	possibly damaging	Het
Eloa	G	A	4: 136,009,822	P488S	probably damaging	Het
Evi5	G	A	5: 107,820,521	R187*	probably null	Het
Fam53a	T	A	5: 33,600,875	L301F	probably damaging	Het
Fmnl3	T	C	15: 99,337,653	K63E	probably damaging	Het
Gast	C	A	11: 100,336,612	Q44K	probably benign	Het
Gm4788	A	G	1: 139,773,924		probably null	Het
Gng10	T	A	4: 59,035,257	V7E	probably benign	Het
Gtf3c5	G	A	2: 28,570,462	T375I	probably benign	Het
Haus5	C	T	7: 30,658,976	W298*	probably null	Het
Hspa14	A	T	2: 3,489,072		probably null	Het
Kcna3	T	C	3: 107,036,424	M1T	probably null	Het
Kcnj15	T	G	16: 95,296,236	L239R	probably damaging	Het
Klhl2	G	T	8: 64,759,808	D232E	probably benign	Het
Lamb3	A	T	1: 193,335,474	I888F	probably damaging	Het
Lars	C	A	18: 42,217,486	M919I	probably benign	Het
Lfng	T	C	5: 140,612,767	V247A	possibly damaging	Het
Lrp1b	C	T	2: 41,789,033	A16T	probably benign	Het
Mamdc2	A	T	19: 23,363,906	I235N	probably damaging	Het
Map9	T	A	3: 82,383,305	L492Q	probably damaging	Het
Mcpt8	A	G	14: 56,085,147	V14A	possibly damaging	Het
Myo1b	T	C	1: 51,768,651	K823R	probably null	Het
Nbea	G	T	3: 56,037,149	T598K	probably damaging	Het
Nrcam	C	A	12: 44,572,300	H877N	probably benign	Het
Nwd2	A	T	5: 63,800,253	I309F	possibly damaging	Het
Phyhd1	G	A	2: 30,274,724		probably null	Het
Pkp2	C	T	16: 16,226,069	T229I	probably damaging	Het
Plagl2	G	A	2: 153,232,691	P97S	probably benign	Het
Plekhh2	C	A	17: 84,566,866	N526K	probably benign	Het
Plin4	A	G	17: 56,103,261	L1217P	probably benign	Het
Polr3e	T	C	7: 120,927,999	S67P	possibly damaging	Het
Postn	A	G	3: 54,385,282	K757E	probably benign	Het
Prpf39	T	A	12: 65,042,813		probably null	Het
Ptprg	C	T	14: 12,166,832	T745I	probably damaging	Het
Pxylp1	C	G	9: 96,825,254	A292P	probably damaging	Het
Rpl35	G	T	2: 39,001,742	D82E	possibly damaging	Het
Slc9a1	G	A	4: 133,422,208	V782I	possibly damaging	Het
Syn2	T	A	6: 115,263,914	M415K	possibly damaging	Het
Tmem117	A	C	15: 95,011,443	I246L	probably benign	Het
Tmem221	A	T	8: 71,558,784	V9E	probably damaging	Het
Ubxn7	T	A	16: 32,372,189		probably null	Het
Vmn2r101	G	T	17: 19,589,850	M299I	possibly damaging	Het
Vmn2r103	T	A	17: 19,794,082	S379T	probably damaging	Het
Vmn2r109	T	C	17: 20,541,178	N639S	probably benign	Het
Wdr26	T	C	1: 181,203,206			Het
Zfp109	T	A	7: 24,228,883	Y367F	probably damaging	Het
Zfp143	G	A	7: 110,086,131	C389Y	probably damaging	Het
Zfp553	G	T	7: 127,236,892		probably null	Het

Other mutations in Nrxn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Nrxn2	APN	19	6473593	missense	possibly damaging	0.84
IGL01020:Nrxn2	APN	19	6493443	missense	probably benign	0.02
IGL01064:Nrxn2	APN	19	6517053	missense	probably damaging	0.97
IGL01561:Nrxn2	APN	19	6490142	missense	probably damaging	1.00
IGL01759:Nrxn2	APN	19	6509929	missense	probably damaging	1.00
IGL02071:Nrxn2	APN	19	6481753	missense	probably damaging	1.00
IGL02085:Nrxn2	APN	19	6492868	missense	possibly damaging	0.83
IGL02132:Nrxn2	APN	19	6472276	missense	probably damaging	1.00
IGL02476:Nrxn2	APN	19	6454985	missense	probably damaging	1.00
IGL02605:Nrxn2	APN	19	6450580	missense	probably benign	0.02
IGL03123:Nrxn2	APN	19	6481737	missense	probably damaging	0.98
IGL03288:Nrxn2	APN	19	6490696	missense	probably damaging	1.00
PIT4687001:Nrxn2	UTSW	19	6481308	missense	probably benign	0.06
R0019:Nrxn2	UTSW	19	6509957	splice site	probably benign
R0257:Nrxn2	UTSW	19	6490698	missense	possibly damaging	0.81
R0305:Nrxn2	UTSW	19	6519283	missense	probably damaging	1.00
R0453:Nrxn2	UTSW	19	6491521	missense	probably damaging	1.00
R0512:Nrxn2	UTSW	19	6517198	missense	probably damaging	1.00
R0539:Nrxn2	UTSW	19	6493404	missense	probably damaging	0.99
R0571:Nrxn2	UTSW	19	6473533	missense	probably damaging	1.00
R1373:Nrxn2	UTSW	19	6472301	missense	probably damaging	1.00
R1434:Nrxn2	UTSW	19	6443612	intron	probably null
R1454:Nrxn2	UTSW	19	6481446	missense	probably damaging	0.98
R1671:Nrxn2	UTSW	19	6473750	missense	probably damaging	1.00
R1692:Nrxn2	UTSW	19	6519268	missense	probably damaging	1.00
R1858:Nrxn2	UTSW	19	6488795	missense	probably benign	0.01
R1859:Nrxn2	UTSW	19	6488795	missense	probably benign	0.01
R2153:Nrxn2	UTSW	19	6504914	missense	probably damaging	1.00
R2196:Nrxn2	UTSW	19	6490109	missense	probably damaging	1.00
R2209:Nrxn2	UTSW	19	6493007	missense	probably benign	0.01
R2278:Nrxn2	UTSW	19	6481853	missense	probably damaging	1.00
R2441:Nrxn2	UTSW	19	6428301	missense	probably damaging	1.00
R3897:Nrxn2	UTSW	19	6519257	missense	probably damaging	1.00
R3943:Nrxn2	UTSW	19	6473335	missense	probably damaging	1.00
R4091:Nrxn2	UTSW	19	6473414	missense	probably damaging	1.00
R4162:Nrxn2	UTSW	19	6532143	missense	probably damaging	1.00
R4164:Nrxn2	UTSW	19	6532143	missense	probably damaging	1.00
R4495:Nrxn2	UTSW	19	6531399	missense	probably benign	0.05
R4599:Nrxn2	UTSW	19	6455252	missense	probably damaging	0.98
R4735:Nrxn2	UTSW	19	6498454	missense	possibly damaging	0.86
R4757:Nrxn2	UTSW	19	6509821	missense	probably damaging	1.00
R4890:Nrxn2	UTSW	19	6448278	missense	possibly damaging	0.90
R5052:Nrxn2	UTSW	19	6455204	missense	probably damaging	1.00
R5311:Nrxn2	UTSW	19	6531398	missense	probably benign	0.05
R5330:Nrxn2	UTSW	19	6490081	missense	probably damaging	0.96
R5331:Nrxn2	UTSW	19	6490081	missense	probably damaging	0.96
R5530:Nrxn2	UTSW	19	6498367	missense	possibly damaging	0.93
R5556:Nrxn2	UTSW	19	6490091	missense	probably damaging	1.00
R5763:Nrxn2	UTSW	19	6531339	missense	probably benign	0.15
R5829:Nrxn2	UTSW	19	6490849	missense	probably benign	0.03
R5988:Nrxn2	UTSW	19	6492871	missense	possibly damaging	0.83
R6003:Nrxn2	UTSW	19	6498328	missense	possibly damaging	0.93
R6032:Nrxn2	UTSW	19	6517132	missense	probably damaging	1.00
R6032:Nrxn2	UTSW	19	6517132	missense	probably damaging	1.00
R6288:Nrxn2	UTSW	19	6490561	missense	probably damaging	1.00
R6373:Nrxn2	UTSW	19	6509830	missense	probably damaging	1.00
R6397:Nrxn2	UTSW	19	6532122	missense	probably damaging	1.00
R6669:Nrxn2	UTSW	19	6481191	missense	probably damaging	1.00
R6980:Nrxn2	UTSW	19	6450579	missense	probably benign	0.04
R6985:Nrxn2	UTSW	19	6481245	missense	probably damaging	1.00
R7184:Nrxn2	UTSW	19	6490552	missense	probably damaging	1.00
R7361:Nrxn2	UTSW	19	6517082	missense	probably benign	0.00
R7576:Nrxn2	UTSW	19	6531510	nonsense	probably null
R7604:Nrxn2	UTSW	19	6531961	missense	probably damaging	1.00
R7631:Nrxn2	UTSW	19	6481795	missense	possibly damaging	0.83
R7768:Nrxn2	UTSW	19	6481379	missense	possibly damaging	0.69
R7805:Nrxn2	UTSW	19	6531706	missense	probably benign
R7896:Nrxn2	UTSW	19	6532053	missense	possibly damaging	0.89
R7979:Nrxn2	UTSW	19	6532053	missense	possibly damaging	0.89
R7998:Nrxn2	UTSW	19	6509875	missense	not run
X0022:Nrxn2	UTSW	19	6509917	missense	probably damaging	1.00
Z1177:Nrxn2	UTSW	19	6498517	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGCCTGAATTCCGTGGTATGC -3'
(R):5'- AGGCTGGAGTCAAAGACCTC -3'

Sequencing Primer
(F):5'- CCGTTTGGTTTCTTAAGACGAAAC -3'
(R):5'- GAGTCAAAGACCTCCCCGGAG -3'

Posted On

2018-04-02