Mutagenetix > Incidental Mutation

Incidental Mutation 'R6336:Vwa3a'

510761

Institutional Source

Beutler Lab

Gene Symbol

Vwa3a

Ensembl Gene

ENSMUSG00000030889

Gene Name

von Willebrand factor A domain containing 3A

Synonyms

E030013G06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6336 (G1)

Quality Score

210.009

Status

Not validated

Chromosome

Chromosomal Location

120739318-120805742 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120762423 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 119 (E119G)

Ref Sequence

ENSEMBL: ENSMUSP00000133029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033180] [ENSMUST00000166668] [ENSMUST00000167213] [ENSMUST00000168600]

AlphaFold

Q3UVV9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033180
AA Change: E119G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000033180
Gene: ENSMUSG00000030889
AA Change: E119G

Domain	Start	End	E-Value	Type
Pfam:VWA_3	142	297	6.3e-30	PFAM
Pfam:VWA_3	483	634	1.2e-17	PFAM
VWA	921	1092	1.89e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166668
AA Change: E119G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129136
Gene: ENSMUSG00000030889
AA Change: E119G

Domain	Start	End	E-Value	Type
Pfam:VWA_3	142	297	1.3e-28	PFAM
Pfam:VWA_3	483	633	5.2e-17	PFAM
VWA	921	1092	1.89e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167213
AA Change: E119G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000133029
Gene: ENSMUSG00000030889
AA Change: E119G

Domain	Start	End	E-Value	Type
Pfam:VWA_3	142	297	1.3e-28	PFAM
Pfam:VWA_3	483	633	5.2e-17	PFAM
VWA	921	1092	1.89e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168600
AA Change: E119G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000132372
Gene: ENSMUSG00000030889
AA Change: E119G

Domain	Start	End	E-Value	Type
Pfam:VWA_3	142	297	8.3e-29	PFAM
Pfam:VWA_3	483	609	5.3e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

98% (45/46)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	G	T	5: 113,183,483	P955Q	possibly damaging	Het
Adgrv1	T	C	13: 81,385,981	N5827S	probably benign	Het
Akt3	T	C	1: 177,031,712	D431G	probably damaging	Het
Anapc16	A	T	10: 59,988,829	V76D	possibly damaging	Het
Ankib1	A	T	5: 3,700,377	Y755*	probably null	Het
Ankrd6	A	G	4: 32,860,411	S11P	probably damaging	Het
Card6	T	A	15: 5,099,164	K917*	probably null	Het
Ccdc152	T	C	15: 3,301,129	I21M	probably damaging	Het
Ccdc40	A	G	11: 119,231,993	E207G	possibly damaging	Het
Clca3a2	G	T	3: 144,806,478	A499E	probably benign	Het
Cntnap5b	C	T	1: 100,358,669	A383V	probably benign	Het
Ddo	T	C	10: 40,633,031	V89A	probably damaging	Het
Depdc5	T	C	5: 32,964,507	176	probably null	Het
Dlgap1	T	A	17: 70,815,289	D904E	probably damaging	Het
Ephb4	T	A	5: 137,372,085	L849H	probably damaging	Het
Fbxl13	A	G	5: 21,523,547		probably null	Het
Fer1l6	C	A	15: 58,559,232	Y245*	probably null	Het
Foxred2	A	G	15: 77,955,764	Y109H	probably damaging	Het
Gabarapl1	A	G	6: 129,537,528	D43G	probably benign	Het
Gabrb1	A	C	5: 72,029,898	E178A	possibly damaging	Het
Gbp11	A	G	5: 105,325,489			Het
Gm31371	A	G	8: 19,924,350	K242E	unknown	Het
Grin3b	C	A	10: 79,976,461	A845E	probably damaging	Het
Hoxd4	A	G	2: 74,727,361	Y28C	probably damaging	Het
Igsf10	G	A	3: 59,330,339	T807M	probably benign	Het
Kcnt1	A	G	2: 25,888,755		probably null	Het
Kdm5a	C	A	6: 120,398,978	T565K	probably damaging	Het
Map7d1	A	G	4: 126,236,682	S412P	probably damaging	Het
Mok	A	G	12: 110,834,124		probably null	Het
Mto1	A	T	9: 78,473,835	I73F	probably damaging	Het
Mtss1l	G	A	8: 110,732,164	D310N	probably damaging	Het
Ncf2	T	C	1: 152,834,070	Y393H	probably damaging	Het
Olfr1299	A	G	2: 111,664,619	H131R	possibly damaging	Het
Olfr1317	A	C	2: 112,142,406	I154L	probably benign	Het
Olfr1384	G	T	11: 49,514,542	K301N	probably damaging	Het
Olfr272	A	T	4: 52,911,459	C112S	probably damaging	Het
Olfr38	T	C	6: 42,762,657	S202P	probably damaging	Het
Olfr67	T	C	7: 103,788,245	T11A	possibly damaging	Het
Phxr2	T	A	10: 99,126,090		probably benign	Het
Rnf17	A	G	14: 56,421,169		probably null	Het
Serpinb9d	T	C	13: 33,194,694	M41T	probably damaging	Het
Slc12a5	T	A	2: 164,992,464		probably null	Het
Slc22a6	G	A	19: 8,622,130	R331H	probably benign	Het
Spg11	G	C	2: 122,112,959		probably null	Het
Src	T	A	2: 157,457,155	V24E	probably benign	Het
Srgap1	A	T	10: 121,925,941	Y101N	probably benign	Het
Vmn2r30	T	A	7: 7,334,308	T110S	probably benign	Het
Whamm	T	A	7: 81,591,764	D274E	probably damaging	Het

Other mutations in Vwa3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01584:Vwa3a	APN	7	120783974	missense	probably benign	0.09
IGL01807:Vwa3a	APN	7	120775506	splice site	probably null
IGL02850:Vwa3a	APN	7	120773292	missense	probably benign	0.00
IGL03253:Vwa3a	APN	7	120778869	missense	probably benign	0.03
PIT4812001:Vwa3a	UTSW	7	120776133	missense	probably damaging	1.00
R0026:Vwa3a	UTSW	7	120780211	missense	probably damaging	1.00
R0114:Vwa3a	UTSW	7	120775380	missense	probably benign	0.06
R1145:Vwa3a	UTSW	7	120793343	missense	probably damaging	0.99
R1145:Vwa3a	UTSW	7	120793343	missense	probably damaging	0.99
R1306:Vwa3a	UTSW	7	120800390	missense	possibly damaging	0.49
R1355:Vwa3a	UTSW	7	120784111	missense	probably damaging	1.00
R1412:Vwa3a	UTSW	7	120780154	missense	probably damaging	1.00
R1466:Vwa3a	UTSW	7	120768165	missense	probably damaging	1.00
R1466:Vwa3a	UTSW	7	120768165	missense	probably damaging	1.00
R1584:Vwa3a	UTSW	7	120768165	missense	probably damaging	1.00
R1686:Vwa3a	UTSW	7	120780148	missense	probably damaging	1.00
R1710:Vwa3a	UTSW	7	120804031	splice site	probably null
R1717:Vwa3a	UTSW	7	120793386	missense	probably benign
R1834:Vwa3a	UTSW	7	120790136	missense	probably benign	0.06
R1912:Vwa3a	UTSW	7	120795627	missense	probably damaging	1.00
R1970:Vwa3a	UTSW	7	120780171	missense	probably damaging	1.00
R1978:Vwa3a	UTSW	7	120758954	missense	probably null	0.00
R2034:Vwa3a	UTSW	7	120782645	nonsense	probably null
R2059:Vwa3a	UTSW	7	120758949	missense	probably damaging	0.98
R2120:Vwa3a	UTSW	7	120792418	missense	probably benign
R2408:Vwa3a	UTSW	7	120773294	missense	probably benign	0.00
R3423:Vwa3a	UTSW	7	120799111	missense	probably damaging	1.00
R3744:Vwa3a	UTSW	7	120752594	missense	probably benign
R3816:Vwa3a	UTSW	7	120800379	missense	probably benign	0.29
R3849:Vwa3a	UTSW	7	120762464	nonsense	probably null
R3904:Vwa3a	UTSW	7	120758876	missense	probably benign
R4031:Vwa3a	UTSW	7	120768232	critical splice donor site	probably null
R4408:Vwa3a	UTSW	7	120778926	missense	probably benign	0.16
R4628:Vwa3a	UTSW	7	120793375	missense	probably benign	0.05
R4629:Vwa3a	UTSW	7	120793375	missense	probably benign	0.05
R4652:Vwa3a	UTSW	7	120778915	missense	probably damaging	0.96
R4884:Vwa3a	UTSW	7	120791701	missense	probably benign
R4948:Vwa3a	UTSW	7	120776264	missense	probably damaging	0.98
R5112:Vwa3a	UTSW	7	120783985	missense	probably damaging	1.00
R5385:Vwa3a	UTSW	7	120790142	missense	possibly damaging	0.91
R5386:Vwa3a	UTSW	7	120790142	missense	possibly damaging	0.91
R5579:Vwa3a	UTSW	7	120768173	missense	probably benign	0.29
R5587:Vwa3a	UTSW	7	120780235	missense	probably damaging	1.00
R5639:Vwa3a	UTSW	7	120790143	missense	probably damaging	0.99
R6102:Vwa3a	UTSW	7	120776138	splice site	probably null
R6239:Vwa3a	UTSW	7	120794234	missense	probably benign	0.00
R6279:Vwa3a	UTSW	7	120782400	missense	probably damaging	0.98
R6298:Vwa3a	UTSW	7	120795651	missense	probably benign	0.01
R6300:Vwa3a	UTSW	7	120782400	missense	probably damaging	0.98
R6907:Vwa3a	UTSW	7	120792581	unclassified	probably benign
R7135:Vwa3a	UTSW	7	120773030	missense	possibly damaging	0.69
R7215:Vwa3a	UTSW	7	120795630	missense	possibly damaging	0.83
R7282:Vwa3a	UTSW	7	120786465	missense	probably benign	0.03
R7351:Vwa3a	UTSW	7	120776336	missense	probably damaging	0.99
R7406:Vwa3a	UTSW	7	120778915	missense	probably damaging	0.96
R7557:Vwa3a	UTSW	7	120795618	missense	possibly damaging	0.90
R7612:Vwa3a	UTSW	7	120752615	missense	probably null	0.47
R7699:Vwa3a	UTSW	7	120752618	missense	probably damaging	1.00
R7823:Vwa3a	UTSW	7	120772962	missense	probably damaging	1.00
R8074:Vwa3a	UTSW	7	120799098	missense	probably benign	0.00
R8730:Vwa3a	UTSW	7	120782687	missense	probably damaging	0.97
R8768:Vwa3a	UTSW	7	120776076	missense	probably damaging	1.00
R8941:Vwa3a	UTSW	7	120776088	missense	probably benign	0.00
R9116:Vwa3a	UTSW	7	120767247	missense
R9134:Vwa3a	UTSW	7	120778436	missense	probably damaging	0.96
R9264:Vwa3a	UTSW	7	120775464	missense	probably benign
R9450:Vwa3a	UTSW	7	120804030	critical splice donor site	probably null
R9464:Vwa3a	UTSW	7	120786459	missense	possibly damaging	0.84
V7732:Vwa3a	UTSW	7	120778949	splice site	probably benign
X0019:Vwa3a	UTSW	7	120768209	missense	probably damaging	0.99
Z1177:Vwa3a	UTSW	7	120759133	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCGACTTCAGTTATAGAGTGAGAT -3'
(R):5'- AGCTATGTCTGTGGGCTTCA -3'

Sequencing Primer
(F):5'- AGGGCTATCCAGTGAAACTCTGTC -3'
(R):5'- CTATGTCTGTGGGCTTCATGTCTG -3'

Posted On

2018-04-02