Incidental Mutation 'R6336:Mtss1l'
ID510763
Institutional Source Beutler Lab
Gene Symbol Mtss1l
Ensembl Gene ENSMUSG00000033763
Gene Namemetastasis suppressor 1-like
SynonymsABBA
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location110721476-110741400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110732164 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 310 (D310N)
Ref Sequence ENSEMBL: ENSMUSP00000050211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052457] [ENSMUST00000144041]
Predicted Effect probably damaging
Transcript: ENSMUST00000052457
AA Change: D310N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050211
Gene: ENSMUSG00000033763
AA Change: D310N

DomainStartEndE-ValueType
Pfam:IMD 15 236 8.1e-108 PFAM
low complexity region 252 274 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 312 330 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
low complexity region 546 562 N/A INTRINSIC
low complexity region 668 690 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133848
Predicted Effect unknown
Transcript: ENSMUST00000141302
AA Change: D227N
SMART Domains Protein: ENSMUSP00000116518
Gene: ENSMUSG00000033763
AA Change: D227N

DomainStartEndE-ValueType
Pfam:IMD 1 122 1e-56 PFAM
low complexity region 138 179 N/A INTRINSIC
low complexity region 202 213 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 286 304 N/A INTRINSIC
low complexity region 347 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141527
Predicted Effect probably damaging
Transcript: ENSMUST00000144041
AA Change: D248N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115220
Gene: ENSMUSG00000033763
AA Change: D248N

DomainStartEndE-ValueType
Pfam:IMD 1 174 3.6e-72 PFAM
low complexity region 190 212 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 306 324 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 606 628 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000149273
AA Change: D231N
SMART Domains Protein: ENSMUSP00000119495
Gene: ENSMUSG00000033763
AA Change: D231N

DomainStartEndE-ValueType
Pfam:IMD 1 126 2.5e-59 PFAM
low complexity region 142 183 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Mtss1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02124:Mtss1l APN 8 110737624 missense probably damaging 1.00
R0620:Mtss1l UTSW 8 110737948 missense probably damaging 0.98
R0685:Mtss1l UTSW 8 110727397 critical splice donor site probably null
R2082:Mtss1l UTSW 8 110726257 critical splice donor site probably null
R2149:Mtss1l UTSW 8 110726383 missense possibly damaging 0.58
R2266:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2267:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2269:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2378:Mtss1l UTSW 8 110738349 missense probably damaging 1.00
R3756:Mtss1l UTSW 8 110730060 missense probably damaging 1.00
R4005:Mtss1l UTSW 8 110739041 frame shift probably null
R4552:Mtss1l UTSW 8 110738505 missense probably damaging 1.00
R4553:Mtss1l UTSW 8 110738505 missense probably damaging 1.00
R4849:Mtss1l UTSW 8 110726243 missense possibly damaging 0.92
R5212:Mtss1l UTSW 8 110729218 missense probably damaging 1.00
R6294:Mtss1l UTSW 8 110727328 missense possibly damaging 0.89
R7090:Mtss1l UTSW 8 110730024 missense probably damaging 1.00
R7580:Mtss1l UTSW 8 110737636 missense possibly damaging 0.95
R7581:Mtss1l UTSW 8 110726213 missense possibly damaging 0.92
R7810:Mtss1l UTSW 8 110726201 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCCATGCCAGAACTCCTC -3'
(R):5'- TCTGAAACACGGGGATACATG -3'

Sequencing Primer
(F):5'- GGGACCTCGTAGTCTGACACTATC -3'
(R):5'- CACGGGGATACATGTTTAAGC -3'
Posted On2018-04-02