Incidental Mutation 'R6328:Ptprc'
ID510784
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Nameprotein tyrosine phosphatase, receptor type, C
SynonymsB220, Ly-5, Lyt-4, CD45, T200
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location138062861-138175708 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 138113678 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 148 (E148*)
Ref Sequence ENSEMBL: ENSMUSP00000142052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301] [ENSMUST00000193650] [ENSMUST00000195533]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112036
SMART Domains Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 5 30 5.8e-13 PFAM
low complexity region 31 64 N/A INTRINSIC
Pfam:CD45 70 129 1.8e-24 PFAM
FN3 233 317 2.28e0 SMART
FN3 333 411 3.48e-1 SMART
transmembrane domain 426 447 N/A INTRINSIC
PTPc 500 762 7.57e-127 SMART
PTPc 791 1077 1.39e-102 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182283
AA Change: E99*
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: E99*

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182755
AA Change: E75*
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: E75*

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183301
AA Change: E238*
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: E238*

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188596
Predicted Effect probably benign
Transcript: ENSMUST00000193650
SMART Domains Protein: ENSMUSP00000141524
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 8.4e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195533
AA Change: E148*
SMART Domains Protein: ENSMUSP00000142052
Gene: ENSMUSG00000026395
AA Change: E148*

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 7.4e-11 PFAM
low complexity region 68 115 N/A INTRINSIC
Pfam:CD45 121 180 2.1e-22 PFAM
Meta Mutation Damage Score 0.6076 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice site probably benign
IGL00486:Ptprc APN 1 138115621 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138080912 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 138068410 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.15
IGL03308:Ptprc APN 1 138126320 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138093001 missense probably damaging 1.00
belittle UTSW 1 138137493 intron probably benign
Chor_muang UTSW 1 138113562 critical splice donor site probably null
Dumpling UTSW 1 138067890 missense probably damaging 1.00
fuchsia UTSW 1 138101041 critical splice donor site probably null
guotie UTSW 1 138068401 nonsense probably null
guotie2 UTSW 1 138094299 missense probably damaging 0.97
Guotie3 UTSW 1 138078451 missense possibly damaging 0.92
Gyoza UTSW 1 138083567 missense probably damaging 1.00
Half_measure UTSW 1 138071249 missense probably damaging 0.98
jirisan UTSW 1 138113678 nonsense probably null
R0013:Ptprc UTSW 1 138113559 unclassified probably null
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.10
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1728:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1729:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1730:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1739:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1762:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1783:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1784:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1785:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.13
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138111188 missense probably benign 0.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3775:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3776:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.04
R4937:Ptprc UTSW 1 138089500 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.07
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5593:Ptprc UTSW 1 138117720 intron probably benign
R5689:Ptprc UTSW 1 138117777 missense probably benign 0.01
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138101056 missense probably benign 0.09
R6026:Ptprc UTSW 1 138071249 missense probably damaging 0.98
R6047:Ptprc UTSW 1 138101041 critical splice donor site probably null
R6173:Ptprc UTSW 1 138067890 missense probably damaging 1.00
R6383:Ptprc UTSW 1 138078451 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138083639 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138113562 critical splice donor site probably null
R6520:Ptprc UTSW 1 138080143 nonsense probably null
R6805:Ptprc UTSW 1 138067885 critical splice donor site probably null
R6830:Ptprc UTSW 1 138072255 critical splice donor site probably null
R6847:Ptprc UTSW 1 138088545 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138078445 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATACATGAAATCCTTCTGTTGCTC -3'
(R):5'- TGCTGAGTACTGAATTTGAAACCC -3'

Sequencing Primer
(F):5'- CTGTTGCTCTAAATACCCAGATAGAG -3'
(R):5'- AGCTGCCATGTTTGGGA -3'
Posted On2018-04-02