Incidental Mutation 'R6328:Tapbpl'
ID510803
Institutional Source Beutler Lab
Gene Symbol Tapbpl
Ensembl Gene ENSMUSG00000038213
Gene NameTAP binding protein-like
SynonymsTAPBPL-R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location125223933-125231860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125224918 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 420 (S420C)
Ref Sequence ENSEMBL: ENSMUSP00000047105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032487] [ENSMUST00000043422] [ENSMUST00000063588] [ENSMUST00000100942]
Predicted Effect probably benign
Transcript: ENSMUST00000032487
SMART Domains Protein: ENSMUSP00000032487
Gene: ENSMUSG00000030337

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 118 1.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043422
AA Change: S420C

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047105
Gene: ENSMUSG00000038213
AA Change: S420C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 202 306 1.11e-5 SMART
IGc1 321 397 3.97e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063588
SMART Domains Protein: ENSMUSP00000063466
Gene: ENSMUSG00000030337

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 118 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100942
SMART Domains Protein: ENSMUSP00000098503
Gene: ENSMUSG00000030337

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 116 1.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205223
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tapasin, or TAPBP (MIM 601962), is a member of the variable-constant Ig superfamily that links major histocompatibility complex (MHC) class I molecules to the transporter associated with antigen processing (TAP; see MIM 170260) in the endoplasmic reticulum (ER). The TAPBP gene is located near the MHC complex on chromosome 6p21.3. TAPBPL is a member of the Ig superfamily that is localized on chromosome 12p13.3, a region somewhat paralogous to the MHC.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Tapbpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03083:Tapbpl APN 6 125228228 unclassified probably null
IGL03308:Tapbpl APN 6 125228179 missense possibly damaging 0.93
R1666:Tapbpl UTSW 6 125230201 missense probably benign 0.00
R3707:Tapbpl UTSW 6 125224695 unclassified probably null
R4521:Tapbpl UTSW 6 125228122 missense probably damaging 1.00
R4744:Tapbpl UTSW 6 125228285 missense probably damaging 1.00
R6290:Tapbpl UTSW 6 125230716 missense probably benign 0.00
R6565:Tapbpl UTSW 6 125228344 missense probably benign 0.00
R7085:Tapbpl UTSW 6 125226488 splice site probably null
R7251:Tapbpl UTSW 6 125226595 missense probably damaging 0.98
X0026:Tapbpl UTSW 6 125230570 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGGACCTTGATGAAGAAGCTG -3'
(R):5'- AGTCTTGAACAAGTGCAGTGC -3'

Sequencing Primer
(F):5'- TTCAATAGGGATAATTCCAAAAGCAG -3'
(R):5'- CAGTGCTGCTGCGTGGG -3'
Posted On2018-04-02