Incidental Mutation 'R6328:Olfr618'
ID510806
Institutional Source Beutler Lab
Gene Symbol Olfr618
Ensembl Gene ENSMUSG00000073945
Gene Nameolfactory receptor 618
SynonymsMOR31-9, GA_x6K02T2PBJ9-6320148-6321104
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103590103-103600448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103597866 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 183 (E183D)
Ref Sequence ENSEMBL: ENSMUSP00000151147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098197] [ENSMUST00000214883] [ENSMUST00000215732]
Predicted Effect probably damaging
Transcript: ENSMUST00000098197
AA Change: E183D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095799
Gene: ENSMUSG00000073945
AA Change: E183D

DomainStartEndE-ValueType
Pfam:7tm_4 34 314 3.1e-109 PFAM
Pfam:7TM_GPCR_Srsx 38 311 6.3e-12 PFAM
Pfam:7tm_1 44 296 8.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214883
AA Change: E183D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215732
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Olfr618
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Olfr618 APN 7 103598162 missense possibly damaging 0.65
IGL00963:Olfr618 APN 7 103597637 unclassified probably null
IGL01772:Olfr618 APN 7 103597913 missense probably benign 0.12
IGL02014:Olfr618 APN 7 103597730 missense probably damaging 1.00
IGL03409:Olfr618 APN 7 103597367 missense possibly damaging 0.51
R0087:Olfr618 UTSW 7 103597721 missense probably benign 0.44
R0831:Olfr618 UTSW 7 103598131 missense probably benign 0.02
R1779:Olfr618 UTSW 7 103597900 missense probably damaging 1.00
R1909:Olfr618 UTSW 7 103597343 missense probably benign 0.01
R5903:Olfr618 UTSW 7 103597921 nonsense probably null
R5952:Olfr618 UTSW 7 103597967 missense probably damaging 1.00
R7264:Olfr618 UTSW 7 103597748 missense probably damaging 0.97
R7573:Olfr618 UTSW 7 103597528 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGTAACCGAGTCTGCCATACTG -3'
(R):5'- ACATGTACCCAGAGCCTTGC -3'

Sequencing Primer
(F):5'- CATACTGCTGGCTATGGCAATTGAC -3'
(R):5'- CGTCGAGCATTTTGAGACG -3'
Posted On2018-04-02