Incidental Mutation 'R6328:Pcp2'
ID510809
Institutional Source Beutler Lab
Gene Symbol Pcp2
Ensembl Gene ENSMUSG00000004630
Gene NamePurkinje cell protein 2 (L7)
SynonymsPcp-2, L7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3623371-3625545 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3624887 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 22 (D22G)
Ref Sequence ENSEMBL: ENSMUSP00000146683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004749] [ENSMUST00000019614] [ENSMUST00000128566] [ENSMUST00000133459] [ENSMUST00000136105] [ENSMUST00000142431] [ENSMUST00000144977] [ENSMUST00000156380] [ENSMUST00000159235] [ENSMUST00000207389] [ENSMUST00000207428] [ENSMUST00000208950]
Predicted Effect probably benign
Transcript: ENSMUST00000004749
SMART Domains Protein: ENSMUSP00000004749
Gene: ENSMUSG00000004630

DomainStartEndE-ValueType
GoLoco 26 48 4.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019614
SMART Domains Protein: ENSMUSP00000019614
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
HAT 48 80 7.56e0 SMART
HAT 93 122 1.92e2 SMART
HAT 124 158 4.89e-2 SMART
HAT 270 305 3.82e-4 SMART
low complexity region 316 333 N/A INTRINSIC
HAT 409 445 1.88e1 SMART
HAT 447 496 2.32e2 SMART
HAT 498 530 1.56e1 SMART
HAT 532 566 5.84e0 SMART
HAT 571 605 3.62e-5 SMART
Blast:HAT 607 641 3e-14 BLAST
Blast:HAT 643 677 2e-15 BLAST
HAT 679 713 2.77e-1 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 823 836 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128566
AA Change: D22G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000133459
AA Change: D6G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122902
Gene: ENSMUSG00000004630
AA Change: D6G

DomainStartEndE-ValueType
GoLoco 7 29 3.29e-6 SMART
GoLoco 47 69 4.47e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136105
AA Change: D22G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121079
Gene: ENSMUSG00000004630
AA Change: D22G

DomainStartEndE-ValueType
GoLoco 23 45 3.29e-6 SMART
GoLoco 63 85 4.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142431
SMART Domains Protein: ENSMUSP00000121403
Gene: ENSMUSG00000004630

DomainStartEndE-ValueType
GoLoco 26 48 4.47e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144977
AA Change: D22G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145855
Predicted Effect probably benign
Transcript: ENSMUST00000156380
SMART Domains Protein: ENSMUSP00000137626
Gene: ENSMUSG00000087687

DomainStartEndE-ValueType
Pfam:DUF2346 1 72 2.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159235
SMART Domains Protein: ENSMUSP00000124237
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 12 47 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159548
SMART Domains Protein: ENSMUSP00000124202
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 10 44 4e-12 BLAST
HAT 46 78 7.56e0 SMART
HAT 91 120 1.92e2 SMART
HAT 122 156 4.89e-2 SMART
Blast:HAT 157 190 4e-12 BLAST
Pfam:TPR_2 243 272 2.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207257
Predicted Effect probably benign
Transcript: ENSMUST00000207389
Predicted Effect probably benign
Transcript: ENSMUST00000207428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208185
Predicted Effect probably benign
Transcript: ENSMUST00000208950
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation do not exhibit any detectable abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Pcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1907:Pcp2 UTSW 8 3624904 intron probably benign
R4916:Pcp2 UTSW 8 3625534 utr 3 prime probably benign
R6141:Pcp2 UTSW 8 3623543 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TGAATACAGACCCCATCCTGAGTC -3'
(R):5'- CAGGGAAGGAGACTCAGGTTTC -3'

Sequencing Primer
(F):5'- TCCTGAGTCCCAAGATCCAC -3'
(R):5'- CATTTAGAGAAATTCTGCAGACCCG -3'
Posted On2018-04-02