Incidental Mutation 'R6328:Bsx'
ID510813
Institutional Source Beutler Lab
Gene Symbol Bsx
Ensembl Gene ENSMUSG00000054360
Gene Namebrain specific homeobox
SynonymsBsx1a, Bsx1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location40874127-40880057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40874223 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 16 (R16W)
Ref Sequence ENSEMBL: ENSMUSP00000068057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067375]
Predicted Effect probably damaging
Transcript: ENSMUST00000067375
AA Change: R16W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068057
Gene: ENSMUSG00000054360
AA Change: R16W

DomainStartEndE-ValueType
low complexity region 57 81 N/A INTRINSIC
HOX 110 172 2.64e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for mutations in Bsx display increased fat mass, decreased food intake after fasting, decreased body temperature, and reduced locomotor activity, but body weight and glucose homoeostasis are similar to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Bsx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Bsx APN 9 40874221 missense probably benign 0.00
IGL02510:Bsx APN 9 40874221 missense possibly damaging 0.49
IGL03295:Bsx APN 9 40874447 splice site probably benign
R0507:Bsx UTSW 9 40876500 splice site probably benign
R0686:Bsx UTSW 9 40876437 missense probably damaging 1.00
R3120:Bsx UTSW 9 40877612 missense possibly damaging 0.95
R4155:Bsx UTSW 9 40876336 missense probably benign 0.04
R5504:Bsx UTSW 9 40874164 start gained probably benign
X0027:Bsx UTSW 9 40877773 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATAGCTGCCGGGATCTGAG -3'
(R):5'- GCCTCTGTTACTTACCTGAGG -3'

Sequencing Primer
(F):5'- GGGATCTGAGCCTGGGC -3'
(R):5'- CTCCCTTATGCAGAGGATGATGAGC -3'
Posted On2018-04-02