Incidental Mutation 'R6328:Syt16'
ID510824
Institutional Source Beutler Lab
Gene Symbol Syt16
Ensembl Gene ENSMUSG00000044912
Gene Namesynaptotagmin XVI
SynonymsStrep14, syt14r, Syt14l
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location73997661-74273267 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 74266693 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 464 (C464*)
Ref Sequence ENSEMBL: ENSMUSP00000152623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110451] [ENSMUST00000221220]
Predicted Effect probably benign
Transcript: ENSMUST00000110451
SMART Domains Protein: ENSMUSP00000106081
Gene: ENSMUSG00000044912

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 70 83 N/A INTRINSIC
C2 270 372 8.91e-4 SMART
low complexity region 386 407 N/A INTRINSIC
C2 425 541 7.07e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000221220
AA Change: C464*
Meta Mutation Damage Score 0.598 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Syt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Syt16 APN 12 74222830 nonsense probably null
IGL01287:Syt16 APN 12 74266739 missense probably damaging 1.00
IGL01401:Syt16 APN 12 74222663 missense possibly damaging 0.66
IGL01780:Syt16 APN 12 74266842 missense probably benign 0.15
IGL02350:Syt16 APN 12 74266842 missense probably benign 0.15
IGL02353:Syt16 APN 12 74129471 missense probably damaging 1.00
IGL02357:Syt16 APN 12 74266842 missense probably benign 0.15
IGL02360:Syt16 APN 12 74129471 missense probably damaging 1.00
IGL02558:Syt16 APN 12 74235058 nonsense probably null
IGL02696:Syt16 APN 12 74129411 missense possibly damaging 0.90
R0701:Syt16 UTSW 12 74235112 missense probably benign 0.01
R1103:Syt16 UTSW 12 74266898 missense probably damaging 1.00
R2002:Syt16 UTSW 12 74235203 missense possibly damaging 0.77
R2079:Syt16 UTSW 12 74238299 missense probably damaging 1.00
R2124:Syt16 UTSW 12 74238235 missense probably damaging 1.00
R3806:Syt16 UTSW 12 74229398 missense possibly damaging 0.93
R3807:Syt16 UTSW 12 74229398 missense possibly damaging 0.93
R4887:Syt16 UTSW 12 74129386 missense probably damaging 0.96
R4889:Syt16 UTSW 12 74129495 missense probably damaging 0.98
R5153:Syt16 UTSW 12 74222768 missense possibly damaging 0.60
R6038:Syt16 UTSW 12 74222535 intron probably null
R6042:Syt16 UTSW 12 74266730 missense probably damaging 1.00
R6752:Syt16 UTSW 12 74229213 critical splice acceptor site probably null
R7248:Syt16 UTSW 12 74266709 missense probably damaging 1.00
R7275:Syt16 UTSW 12 74266709 missense probably damaging 1.00
R7276:Syt16 UTSW 12 74266709 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTGAAGAATACCATGGC -3'
(R):5'- TTCCAACAGCGTATGCCAC -3'

Sequencing Primer
(F):5'- CATGGCATGGAAAAATGTGAAGTC -3'
(R):5'- AGGTCTGCTGGCCCTTG -3'
Posted On2018-04-02