Incidental Mutation 'R6328:Pdlim7'
ID510827
Institutional Source Beutler Lab
Gene Symbol Pdlim7
Ensembl Gene ENSMUSG00000021493
Gene NamePDZ and LIM domain 7
SynonymsEnigma, 2410002J21Rik, 1110003B01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location55495795-55513676 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 55508092 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046246] [ENSMUST00000069929] [ENSMUST00000069968] [ENSMUST00000131306] [ENSMUST00000144288] [ENSMUST00000153426] [ENSMUST00000155098]
Predicted Effect probably benign
Transcript: ENSMUST00000046246
SMART Domains Protein: ENSMUSP00000047173
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
low complexity region 209 223 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
LIM 281 332 3.69e-18 SMART
LIM 340 391 8.29e-21 SMART
LIM 399 452 2.47e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069929
SMART Domains Protein: ENSMUSP00000064219
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069968
SMART Domains Protein: ENSMUSP00000070153
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128911
Predicted Effect unknown
Transcript: ENSMUST00000131306
AA Change: R172S
SMART Domains Protein: ENSMUSP00000119753
Gene: ENSMUSG00000021493
AA Change: R172S

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136583
Predicted Effect probably benign
Transcript: ENSMUST00000144288
SMART Domains Protein: ENSMUSP00000121614
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153230
Predicted Effect probably benign
Transcript: ENSMUST00000153426
SMART Domains Protein: ENSMUSP00000118867
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
Pfam:PDZ 3 58 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155098
SMART Domains Protein: ENSMUSP00000120465
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
low complexity region 209 223 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
LIM 281 332 3.69e-18 SMART
LIM 340 391 8.29e-21 SMART
LIM 399 452 2.47e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184300
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is representative of a family of proteins composed of conserved PDZ and LIM domains. LIM domains are proposed to function in protein-protein recognition in a variety of contexts including gene transcription and development and in cytoskeletal interaction. The LIM domains of this protein bind to protein kinases, whereas the PDZ domain binds to actin filaments. The gene product is involved in the assembly of an actin filament-associated complex essential for transmission of ret/ptc2 mitogenic signaling. The biological function is likely to be that of an adapter, with the PDZ domain localizing the LIM-binding proteins to actin filaments of both skeletal muscle and nonmuscle tissues. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit heart defects and hemostatic dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Pdlim7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0737:Pdlim7 UTSW 13 55504880 intron probably null
R1518:Pdlim7 UTSW 13 55508294 nonsense probably null
R1857:Pdlim7 UTSW 13 55506045 missense probably damaging 1.00
R1886:Pdlim7 UTSW 13 55506168 missense probably benign 0.34
R1887:Pdlim7 UTSW 13 55506168 missense probably benign 0.34
R5139:Pdlim7 UTSW 13 55507056 missense probably damaging 1.00
R5367:Pdlim7 UTSW 13 55506162 missense probably benign 0.01
R5866:Pdlim7 UTSW 13 55498688 missense probably damaging 1.00
R5922:Pdlim7 UTSW 13 55508955 missense probably damaging 1.00
R6787:Pdlim7 UTSW 13 55508997 missense probably damaging 1.00
R6980:Pdlim7 UTSW 13 55508228 missense probably benign 0.35
X0010:Pdlim7 UTSW 13 55508984 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACTTGTCAGAGGTCTGCAC -3'
(R):5'- GGTACACTTTTGCACCAAGC -3'

Sequencing Primer
(F):5'- TCTGCACCTGTGAAGGAAAC -3'
(R):5'- GCCTCCCTCAACAAGACGG -3'
Posted On2018-04-02