Incidental Mutation 'R6330:Celf2'
ID510841
Institutional Source Beutler Lab
Gene Symbol Celf2
Ensembl Gene ENSMUSG00000002107
Gene NameCUGBP, Elav-like family member 2
SynonymsNapor-2, ETR-3, B230345P09Rik, Cugbp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R6330 (G1)
Quality Score210.009
Status Validated
Chromosome2
Chromosomal Location6539694-7509563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6884955 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 2 (F2L)
Ref Sequence ENSEMBL: ENSMUSP00000110584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002176] [ENSMUST00000114923] [ENSMUST00000114924] [ENSMUST00000114934] [ENSMUST00000137733] [ENSMUST00000170438] [ENSMUST00000182404] [ENSMUST00000182706] [ENSMUST00000182851] [ENSMUST00000183091] [ENSMUST00000183209]
Predicted Effect probably benign
Transcript: ENSMUST00000002176
SMART Domains Protein: ENSMUSP00000002176
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 326 355 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
RRM 400 473 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114923
SMART Domains Protein: ENSMUSP00000110573
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 41 120 1.6e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114924
AA Change: F2L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110574
Gene: ENSMUSG00000002107
AA Change: F2L

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114934
AA Change: F2L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110584
Gene: ENSMUSG00000002107
AA Change: F2L

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137733
SMART Domains Protein: ENSMUSP00000138694
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
internal_repeat_1 109 134 2.62e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138347
SMART Domains Protein: ENSMUSP00000114914
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 24 102 1.29e-17 SMART
RRM 116 184 1.64e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142774
Predicted Effect probably benign
Transcript: ENSMUST00000170438
AA Change: F2L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130829
Gene: ENSMUSG00000002107
AA Change: F2L

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
RRM 384 467 4.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182404
SMART Domains Protein: ENSMUSP00000138769
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 22 97 4.22e-22 SMART
low complexity region 107 136 N/A INTRINSIC
low complexity region 165 192 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 254 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182560
Predicted Effect probably benign
Transcript: ENSMUST00000182706
SMART Domains Protein: ENSMUSP00000138764
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 362 391 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
RRM 436 509 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182851
SMART Domains Protein: ENSMUSP00000138363
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
low complexity region 350 379 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
RRM 424 497 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183091
SMART Domains Protein: ENSMUSP00000138795
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
RRM 366 449 4.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183209
SMART Domains Protein: ENSMUSP00000138355
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
RRM 378 461 4.92e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T A 16: 88,627,051 H184L probably benign Het
9230104L09Rik G T 2: 148,850,825 A19D probably damaging Het
Ccar1 A G 10: 62,764,533 Y540H probably damaging Het
Cfap57 T C 4: 118,569,396 I1119V probably benign Het
Clec4f T C 6: 83,652,868 Q236R probably damaging Het
Cyp4a31 C T 4: 115,563,877 P54L probably damaging Het
Dapk1 T C 13: 60,761,326 V1251A probably benign Het
Dnah7b G A 1: 46,340,175 V3690M probably damaging Het
Dock9 A T 14: 121,605,243 M1K probably null Het
Emb T G 13: 117,249,130 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
F7 C T 8: 13,035,140 H389Y probably damaging Het
Fam111a T A 19: 12,586,902 I49K probably damaging Het
Fam50b T G 13: 34,746,669 S43A probably benign Het
Gbp7 A T 3: 142,546,498 Y614F probably benign Het
Gli3 T A 13: 15,724,732 D901E probably damaging Het
Hhatl C T 9: 121,788,225 probably null Het
Idua T A 5: 108,681,708 L432H probably benign Het
Ighv10-3 T A 12: 114,523,466 T112S possibly damaging Het
Kcnj6 T A 16: 94,762,601 D346V possibly damaging Het
Lrba A G 3: 86,348,357 D1002G probably benign Het
Lrrd1 T A 5: 3,850,629 S311R probably damaging Het
Mafk A G 5: 139,799,193 N4S probably benign Het
Mfsd14b T C 13: 65,095,686 Y48C probably damaging Het
Mindy3 C T 2: 12,356,933 A333T probably damaging Het
Mlxip G A 5: 123,394,952 C8Y probably benign Het
Mthfd1l A T 10: 3,980,234 M110L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Olfr128 T C 17: 37,923,794 V76A possibly damaging Het
Olfr366 A T 2: 37,220,124 I212F probably benign Het
Orc2 C A 1: 58,500,334 V49L probably benign Het
Pfkp C T 13: 6,585,250 probably benign Het
Pkd1l3 T C 8: 109,646,909 F1359S probably benign Het
Ralgps1 A T 2: 33,174,443 I222N probably damaging Het
Rrad T G 8: 104,629,860 E136A probably benign Het
Serpine3 T C 14: 62,664,981 S14P probably benign Het
Slc2a12 A G 10: 22,664,995 T250A probably benign Het
Slc4a5 T G 6: 83,226,374 F85L probably benign Het
Stx18 T A 5: 38,126,917 probably null Het
Tbcd T C 11: 121,497,086 S348P probably benign Het
Usp9y T C Y: 1,340,123 T1419A probably benign Homo
Vmn2r69 T C 7: 85,411,627 S250G probably benign Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Vwa5b2 T A 16: 20,601,977 I846N probably damaging Het
Zfp74 A T 7: 29,937,987 Y33N probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Other mutations in Celf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Celf2 APN 2 6721577 missense probably benign 0.00
IGL01974:Celf2 APN 2 6604031 missense probably damaging 1.00
IGL02159:Celf2 APN 2 6604177 nonsense probably null
LCD18:Celf2 UTSW 2 6779076 intron probably benign
R0113:Celf2 UTSW 2 6624714 missense probably damaging 1.00
R0511:Celf2 UTSW 2 6604176 missense probably damaging 1.00
R0711:Celf2 UTSW 2 6721415 critical splice donor site probably null
R1755:Celf2 UTSW 2 6884958 start codon destroyed probably benign 0.01
R1802:Celf2 UTSW 2 6549933 missense probably damaging 1.00
R1898:Celf2 UTSW 2 6604164 missense probably damaging 1.00
R1912:Celf2 UTSW 2 6615753 missense probably damaging 1.00
R2422:Celf2 UTSW 2 6553889 missense probably damaging 1.00
R2848:Celf2 UTSW 2 6604125 missense probably damaging 0.96
R2849:Celf2 UTSW 2 6604125 missense probably damaging 0.96
R3708:Celf2 UTSW 2 6624678 missense probably damaging 1.00
R4295:Celf2 UTSW 2 6604064 missense probably benign 0.10
R4601:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4602:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4610:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4611:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4667:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4668:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4669:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4790:Celf2 UTSW 2 6549903 missense probably damaging 1.00
R5022:Celf2 UTSW 2 6607847 intron probably benign
R5369:Celf2 UTSW 2 7081081 intron probably benign
R5540:Celf2 UTSW 2 6553932 missense probably benign 0.43
R5805:Celf2 UTSW 2 6553787 missense probably damaging 1.00
R5913:Celf2 UTSW 2 7081158 start codon destroyed probably null 0.02
R7505:Celf2 UTSW 2 6624700 missense probably damaging 1.00
R7662:Celf2 UTSW 2 6553917 missense probably damaging 1.00
X0018:Celf2 UTSW 2 6553913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATTGGCGTCTCCACCAG -3'
(R):5'- GAGTGCATGCAAACAAGCTCTC -3'

Sequencing Primer
(F):5'- GCTCTCAAAACTAGAAAAGCCTATG -3'
(R):5'- GCCTAGATAACATAACTTGTCGGAG -3'
Posted On2018-04-02