Incidental Mutation 'R6330:Hhatl'
ID510861
Institutional Source Beutler Lab
Gene Symbol Hhatl
Ensembl Gene ENSMUSG00000032523
Gene Namehedgehog acyltransferase-like
SynonymsGup1, 1110011D13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6330 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location121784016-121792507 bp(-) (GRCm38)
Type of Mutationunclassified (4407 bp from exon)
DNA Base Change (assembly) C to T at 121788225 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035110] [ENSMUST00000098272] [ENSMUST00000163981] [ENSMUST00000214768] [ENSMUST00000215477] [ENSMUST00000215910] [ENSMUST00000217652]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035110
AA Change: R314H

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035110
Gene: ENSMUSG00000032523
AA Change: R314H

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:MBOAT 63 448 2.7e-15 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098272
SMART Domains Protein: ENSMUSP00000095873
Gene: ENSMUSG00000074001

DomainStartEndE-ValueType
BTB 33 128 4.61e-29 SMART
BACK 133 239 9.46e-30 SMART
low complexity region 262 276 N/A INTRINSIC
Blast:BTB 300 355 2e-27 BLAST
Kelch 360 412 1.77e0 SMART
Kelch 413 462 1.29e-2 SMART
Kelch 463 510 4.68e-9 SMART
Kelch 511 557 2.06e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163981
AA Change: R314H

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131971
Gene: ENSMUSG00000032523
AA Change: R314H

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Pfam:MBOAT 97 444 3.7e-16 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214768
Predicted Effect probably benign
Transcript: ENSMUST00000215477
Predicted Effect probably benign
Transcript: ENSMUST00000215910
Predicted Effect probably benign
Transcript: ENSMUST00000217652
Meta Mutation Damage Score 0.0926 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T A 16: 88,627,051 H184L probably benign Het
9230104L09Rik G T 2: 148,850,825 A19D probably damaging Het
Ccar1 A G 10: 62,764,533 Y540H probably damaging Het
Celf2 A G 2: 6,884,955 F2L probably benign Het
Cfap57 T C 4: 118,569,396 I1119V probably benign Het
Clec4f T C 6: 83,652,868 Q236R probably damaging Het
Cyp4a31 C T 4: 115,563,877 P54L probably damaging Het
Dapk1 T C 13: 60,761,326 V1251A probably benign Het
Dnah7b G A 1: 46,340,175 V3690M probably damaging Het
Dock9 A T 14: 121,605,243 M1K probably null Het
Emb T G 13: 117,249,130 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
F7 C T 8: 13,035,140 H389Y probably damaging Het
Fam111a T A 19: 12,586,902 I49K probably damaging Het
Fam50b T G 13: 34,746,669 S43A probably benign Het
Gbp7 A T 3: 142,546,498 Y614F probably benign Het
Gli3 T A 13: 15,724,732 D901E probably damaging Het
Idua T A 5: 108,681,708 L432H probably benign Het
Ighv10-3 T A 12: 114,523,466 T112S possibly damaging Het
Kcnj6 T A 16: 94,762,601 D346V possibly damaging Het
Lrba A G 3: 86,348,357 D1002G probably benign Het
Lrrd1 T A 5: 3,850,629 S311R probably damaging Het
Mafk A G 5: 139,799,193 N4S probably benign Het
Mfsd14b T C 13: 65,095,686 Y48C probably damaging Het
Mindy3 C T 2: 12,356,933 A333T probably damaging Het
Mlxip G A 5: 123,394,952 C8Y probably benign Het
Mthfd1l A T 10: 3,980,234 M110L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Olfr128 T C 17: 37,923,794 V76A possibly damaging Het
Olfr366 A T 2: 37,220,124 I212F probably benign Het
Orc2 C A 1: 58,500,334 V49L probably benign Het
Pfkp C T 13: 6,585,250 probably benign Het
Pkd1l3 T C 8: 109,646,909 F1359S probably benign Het
Ralgps1 A T 2: 33,174,443 I222N probably damaging Het
Rrad T G 8: 104,629,860 E136A probably benign Het
Serpine3 T C 14: 62,664,981 S14P probably benign Het
Slc2a12 A G 10: 22,664,995 T250A probably benign Het
Slc4a5 T G 6: 83,226,374 F85L probably benign Het
Stx18 T A 5: 38,126,917 probably null Het
Tbcd T C 11: 121,497,086 S348P probably benign Het
Usp9y T C Y: 1,340,123 T1419A probably benign Homo
Vmn2r69 T C 7: 85,411,627 S250G probably benign Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Vwa5b2 T A 16: 20,601,977 I846N probably damaging Het
Zfp74 A T 7: 29,937,987 Y33N probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Other mutations in Hhatl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Hhatl APN 9 121789791 missense probably benign 0.21
R0270:Hhatl UTSW 9 121784720 missense probably benign 0.14
R0399:Hhatl UTSW 9 121788762 missense probably benign 0.00
R0417:Hhatl UTSW 9 121788762 missense probably benign 0.00
R0436:Hhatl UTSW 9 121788762 missense probably benign 0.00
R1741:Hhatl UTSW 9 121789059 missense possibly damaging 0.67
R2250:Hhatl UTSW 9 121788171 missense possibly damaging 0.67
R2284:Hhatl UTSW 9 121789582 missense probably damaging 1.00
R2513:Hhatl UTSW 9 121789170 missense probably benign 0.13
R4278:Hhatl UTSW 9 121784219 missense probably benign
R4717:Hhatl UTSW 9 121789877 missense probably damaging 1.00
R4851:Hhatl UTSW 9 121789011 missense probably damaging 1.00
R5759:Hhatl UTSW 9 121788277 missense probably damaging 1.00
R6387:Hhatl UTSW 9 121790401 missense probably benign 0.09
R6460:Hhatl UTSW 9 121789522 missense probably benign 0.32
R6541:Hhatl UTSW 9 121785144 missense probably damaging 1.00
R6651:Hhatl UTSW 9 121784702 missense probably damaging 1.00
R6670:Hhatl UTSW 9 121789071 missense probably damaging 0.96
R6914:Hhatl UTSW 9 121788180 missense probably benign
R6942:Hhatl UTSW 9 121788180 missense probably benign
R7026:Hhatl UTSW 9 121788273 missense probably benign 0.26
R7251:Hhatl UTSW 9 121785050 critical splice donor site probably null
R7323:Hhatl UTSW 9 121789586 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTGGTATCGTTCTCCAAC -3'
(R):5'- TCTATCCATGGGAGAGGCAAGG -3'

Sequencing Primer
(F):5'- TCATTGATACCACGGTCGAAGTG -3'
(R):5'- CAAGGCTCAGAATTTGGTTGTTC -3'
Posted On2018-04-02