Incidental Mutation 'R6330:Ccar1'
ID510864
Institutional Source Beutler Lab
Gene Symbol Ccar1
Ensembl Gene ENSMUSG00000020074
Gene Namecell division cycle and apoptosis regulator 1
Synonyms9430036H15Rik, Carp1, 2610511G16Rik
MMRRC Submission
Accession Numbers

Genbank: NM_026201.3; Ensembl: ENSMUST00000020268

Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R6330 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location62743928-62792286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62764533 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 540 (Y540H)
Ref Sequence ENSEMBL: ENSMUSP00000151895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020268] [ENSMUST00000219527]
Predicted Effect probably damaging
Transcript: ENSMUST00000020268
AA Change: Y540H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020268
Gene: ENSMUSG00000020074
AA Change: Y540H

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
low complexity region 62 106 N/A INTRINSIC
Pfam:S1-like 144 201 1.7e-34 PFAM
low complexity region 236 254 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 358 N/A INTRINSIC
DBC1 475 606 4.46e-90 SMART
SAP 633 667 5.25e-9 SMART
Blast:HDc 753 784 1e-7 BLAST
coiled coil region 792 819 N/A INTRINSIC
low complexity region 871 895 N/A INTRINSIC
SCOP:d1hqva_ 898 964 5e-3 SMART
Blast:HDc 921 979 5e-17 BLAST
coiled coil region 1029 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219441
Predicted Effect probably damaging
Transcript: ENSMUST00000219527
AA Change: Y540H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220236
Meta Mutation Damage Score 0.3356 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (46/47)
Allele List at MGI

All alleles(45) : Targeted, other(4) Gene trapped(41)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T A 16: 88,627,051 H184L probably benign Het
9230104L09Rik G T 2: 148,850,825 A19D probably damaging Het
Celf2 A G 2: 6,884,955 F2L probably benign Het
Cfap57 T C 4: 118,569,396 I1119V probably benign Het
Clec4f T C 6: 83,652,868 Q236R probably damaging Het
Cyp4a31 C T 4: 115,563,877 P54L probably damaging Het
Dapk1 T C 13: 60,761,326 V1251A probably benign Het
Dnah7b G A 1: 46,340,175 V3690M probably damaging Het
Dock9 A T 14: 121,605,243 M1K probably null Het
Emb T G 13: 117,249,130 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
F7 C T 8: 13,035,140 H389Y probably damaging Het
Fam111a T A 19: 12,586,902 I49K probably damaging Het
Fam50b T G 13: 34,746,669 S43A probably benign Het
Gbp7 A T 3: 142,546,498 Y614F probably benign Het
Gli3 T A 13: 15,724,732 D901E probably damaging Het
Hhatl C T 9: 121,788,225 probably null Het
Idua T A 5: 108,681,708 L432H probably benign Het
Ighv10-3 T A 12: 114,523,466 T112S possibly damaging Het
Kcnj6 T A 16: 94,762,601 D346V possibly damaging Het
Lrba A G 3: 86,348,357 D1002G probably benign Het
Lrrd1 T A 5: 3,850,629 S311R probably damaging Het
Mafk A G 5: 139,799,193 N4S probably benign Het
Mfsd14b T C 13: 65,095,686 Y48C probably damaging Het
Mindy3 C T 2: 12,356,933 A333T probably damaging Het
Mlxip G A 5: 123,394,952 C8Y probably benign Het
Mthfd1l A T 10: 3,980,234 M110L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Olfr128 T C 17: 37,923,794 V76A possibly damaging Het
Olfr366 A T 2: 37,220,124 I212F probably benign Het
Orc2 C A 1: 58,500,334 V49L probably benign Het
Pfkp C T 13: 6,585,250 probably benign Het
Pkd1l3 T C 8: 109,646,909 F1359S probably benign Het
Ralgps1 A T 2: 33,174,443 I222N probably damaging Het
Rrad T G 8: 104,629,860 E136A probably benign Het
Serpine3 T C 14: 62,664,981 S14P probably benign Het
Slc2a12 A G 10: 22,664,995 T250A probably benign Het
Slc4a5 T G 6: 83,226,374 F85L probably benign Het
Stx18 T A 5: 38,126,917 probably null Het
Tbcd T C 11: 121,497,086 S348P probably benign Het
Usp9y T C Y: 1,340,123 T1419A probably benign Homo
Vmn2r69 T C 7: 85,411,627 S250G probably benign Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Vwa5b2 T A 16: 20,601,977 I846N probably damaging Het
Zfp74 A T 7: 29,937,987 Y33N probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Other mutations in Ccar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Ccar1 APN 10 62753234 missense unknown
IGL01291:Ccar1 APN 10 62756649 missense probably damaging 1.00
IGL01364:Ccar1 APN 10 62776874 unclassified probably null
IGL01777:Ccar1 APN 10 62780577 missense possibly damaging 0.71
IGL01958:Ccar1 APN 10 62790935 missense possibly damaging 0.94
IGL03096:Ccar1 APN 10 62764333 missense probably benign 0.20
Lonk UTSW 10 62764533 missense probably damaging 1.00
1mM(1):Ccar1 UTSW 10 62783886 missense probably benign 0.00
ANU05:Ccar1 UTSW 10 62756649 missense probably damaging 1.00
R0440:Ccar1 UTSW 10 62780457 missense possibly damaging 0.94
R1295:Ccar1 UTSW 10 62783882 critical splice donor site probably null
R1573:Ccar1 UTSW 10 62750655 missense unknown
R1585:Ccar1 UTSW 10 62751001 missense unknown
R1633:Ccar1 UTSW 10 62751014 missense unknown
R1840:Ccar1 UTSW 10 62763510 missense probably damaging 0.98
R1854:Ccar1 UTSW 10 62764517 missense probably damaging 1.00
R1905:Ccar1 UTSW 10 62776658 missense possibly damaging 0.85
R2011:Ccar1 UTSW 10 62776694 missense probably benign 0.03
R2041:Ccar1 UTSW 10 62766048 missense probably damaging 1.00
R2202:Ccar1 UTSW 10 62745287 missense unknown
R2327:Ccar1 UTSW 10 62764382 missense probably damaging 1.00
R2932:Ccar1 UTSW 10 62776759 missense probably benign 0.08
R3040:Ccar1 UTSW 10 62756494 missense possibly damaging 0.83
R4647:Ccar1 UTSW 10 62747417 nonsense probably null
R4829:Ccar1 UTSW 10 62745335 missense unknown
R4887:Ccar1 UTSW 10 62753218 missense unknown
R4888:Ccar1 UTSW 10 62753218 missense unknown
R5000:Ccar1 UTSW 10 62751005 missense unknown
R5207:Ccar1 UTSW 10 62753281 missense unknown
R5214:Ccar1 UTSW 10 62770961 missense probably damaging 1.00
R5644:Ccar1 UTSW 10 62771978 missense probably benign 0.16
R6035:Ccar1 UTSW 10 62751785 missense unknown
R6035:Ccar1 UTSW 10 62751785 missense unknown
R6063:Ccar1 UTSW 10 62776717 missense possibly damaging 0.70
R6370:Ccar1 UTSW 10 62764529 missense probably damaging 1.00
R6828:Ccar1 UTSW 10 62764430 missense probably damaging 0.98
R6943:Ccar1 UTSW 10 62746936 missense unknown
V8831:Ccar1 UTSW 10 62747406 missense unknown
X0017:Ccar1 UTSW 10 62765340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCTTCTCGACCAGCTG -3'
(R):5'- ATGGGTAGCTCTGTAAACATATCAG -3'

Sequencing Primer
(F):5'- CTGCTGCTTGTATCCTCGGGAG -3'
(R):5'- CCAACCTCAAGTTCTTGCA -3'
Posted On2018-04-02