Incidental Mutation 'R6330:Mfsd14b'
ID510872
Institutional Source Beutler Lab
Gene Symbol Mfsd14b
Ensembl Gene ENSMUSG00000038212
Gene Namemajor facilitator superfamily domain containing 14B
Synonyms5730414C17Rik, Hiatl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6330 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location65064663-65112975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65095686 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 48 (Y48C)
Ref Sequence ENSEMBL: ENSMUSP00000118180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054730] [ENSMUST00000155487]
Predicted Effect probably damaging
Transcript: ENSMUST00000054730
AA Change: Y48C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062566
Gene: ENSMUSG00000038212
AA Change: Y48C

DomainStartEndE-ValueType
Pfam:MFS_1 50 396 4.5e-33 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155487
AA Change: Y48C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118180
Gene: ENSMUSG00000038212
AA Change: Y48C

DomainStartEndE-ValueType
Pfam:MFS_1 50 396 4.6e-33 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Meta Mutation Damage Score 0.2881 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T A 16: 88,627,051 H184L probably benign Het
9230104L09Rik G T 2: 148,850,825 A19D probably damaging Het
Ccar1 A G 10: 62,764,533 Y540H probably damaging Het
Celf2 A G 2: 6,884,955 F2L probably benign Het
Cfap57 T C 4: 118,569,396 I1119V probably benign Het
Clec4f T C 6: 83,652,868 Q236R probably damaging Het
Cyp4a31 C T 4: 115,563,877 P54L probably damaging Het
Dapk1 T C 13: 60,761,326 V1251A probably benign Het
Dnah7b G A 1: 46,340,175 V3690M probably damaging Het
Dock9 A T 14: 121,605,243 M1K probably null Het
Emb T G 13: 117,249,130 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
F7 C T 8: 13,035,140 H389Y probably damaging Het
Fam111a T A 19: 12,586,902 I49K probably damaging Het
Fam50b T G 13: 34,746,669 S43A probably benign Het
Gbp7 A T 3: 142,546,498 Y614F probably benign Het
Gli3 T A 13: 15,724,732 D901E probably damaging Het
Hhatl C T 9: 121,788,225 probably null Het
Idua T A 5: 108,681,708 L432H probably benign Het
Ighv10-3 T A 12: 114,523,466 T112S possibly damaging Het
Kcnj6 T A 16: 94,762,601 D346V possibly damaging Het
Lrba A G 3: 86,348,357 D1002G probably benign Het
Lrrd1 T A 5: 3,850,629 S311R probably damaging Het
Mafk A G 5: 139,799,193 N4S probably benign Het
Mindy3 C T 2: 12,356,933 A333T probably damaging Het
Mlxip G A 5: 123,394,952 C8Y probably benign Het
Mthfd1l A T 10: 3,980,234 M110L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Olfr128 T C 17: 37,923,794 V76A possibly damaging Het
Olfr366 A T 2: 37,220,124 I212F probably benign Het
Orc2 C A 1: 58,500,334 V49L probably benign Het
Pfkp C T 13: 6,585,250 probably benign Het
Pkd1l3 T C 8: 109,646,909 F1359S probably benign Het
Ralgps1 A T 2: 33,174,443 I222N probably damaging Het
Rrad T G 8: 104,629,860 E136A probably benign Het
Serpine3 T C 14: 62,664,981 S14P probably benign Het
Slc2a12 A G 10: 22,664,995 T250A probably benign Het
Slc4a5 T G 6: 83,226,374 F85L probably benign Het
Stx18 T A 5: 38,126,917 probably null Het
Tbcd T C 11: 121,497,086 S348P probably benign Het
Usp9y T C Y: 1,340,123 T1419A probably benign Homo
Vmn2r69 T C 7: 85,411,627 S250G probably benign Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Vwa5b2 T A 16: 20,601,977 I846N probably damaging Het
Zfp74 A T 7: 29,937,987 Y33N probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Other mutations in Mfsd14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Mfsd14b APN 13 65066701 missense probably benign 0.00
IGL01935:Mfsd14b APN 13 65067925 missense probably benign
IGL01957:Mfsd14b APN 13 65087093 missense possibly damaging 0.90
R0555:Mfsd14b UTSW 13 65078445 missense probably benign 0.34
R0601:Mfsd14b UTSW 13 65087150 missense possibly damaging 0.88
R0988:Mfsd14b UTSW 13 65112493 splice site probably benign
R1136:Mfsd14b UTSW 13 65095692 missense probably benign 0.22
R1494:Mfsd14b UTSW 13 65095671 missense probably damaging 1.00
R2087:Mfsd14b UTSW 13 65067982 missense probably damaging 1.00
R4223:Mfsd14b UTSW 13 65066608 utr 3 prime probably benign
R5103:Mfsd14b UTSW 13 65087093 missense possibly damaging 0.56
R5568:Mfsd14b UTSW 13 65072122 splice site probably null
R5603:Mfsd14b UTSW 13 65073606 missense probably benign 0.00
R6181:Mfsd14b UTSW 13 65112584 missense probably benign 0.00
R6649:Mfsd14b UTSW 13 65066785 missense probably damaging 1.00
R7460:Mfsd14b UTSW 13 65072023 missense probably damaging 1.00
R7605:Mfsd14b UTSW 13 65066777 missense probably benign
X0017:Mfsd14b UTSW 13 65072053 missense probably benign 0.08
X0027:Mfsd14b UTSW 13 65072011 missense probably benign 0.16
X0063:Mfsd14b UTSW 13 65078485 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCACTTACCAATTTTCTATTTATCAGG -3'
(R):5'- GATGAGAATTGTCTTGGTAGTCTCTT -3'

Sequencing Primer
(F):5'- TTATCAGGTCCTTAAATCAAAACCC -3'
(R):5'- GCAGTAATCTCTCAGCCAGCTG -3'
Posted On2018-04-02