Incidental Mutation 'R6330:Vwa5b2'
ID510876
Institutional Source Beutler Lab
Gene Symbol Vwa5b2
Ensembl Gene ENSMUSG00000046613
Gene Namevon Willebrand factor A domain containing 5B2
SynonymsEG328644
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6330 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20589471-20605377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20601977 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 846 (I846N)
Ref Sequence ENSEMBL: ENSMUSP00000123727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045918] [ENSMUST00000096197] [ENSMUST00000100074] [ENSMUST00000123774] [ENSMUST00000147867] [ENSMUST00000149236] [ENSMUST00000159780] [ENSMUST00000231362] [ENSMUST00000231386] [ENSMUST00000231387] [ENSMUST00000231471] [ENSMUST00000231531] [ENSMUST00000231749] [ENSMUST00000231904] [ENSMUST00000232319] [ENSMUST00000232451] [ENSMUST00000232458]
Predicted Effect probably benign
Transcript: ENSMUST00000045918
SMART Domains Protein: ENSMUSP00000045272
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
Pfam:ALG3 47 406 2.5e-145 PFAM
low complexity region 407 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046188
Predicted Effect probably damaging
Transcript: ENSMUST00000096197
AA Change: I846N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093911
Gene: ENSMUSG00000046613
AA Change: I846N

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 7.3e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100074
SMART Domains Protein: ENSMUSP00000097652
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 1.9e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 572 586 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117019
Predicted Effect probably benign
Transcript: ENSMUST00000123774
SMART Domains Protein: ENSMUSP00000123378
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127454
SMART Domains Protein: ENSMUSP00000120559
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ALG3 51 118 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147867
Predicted Effect probably benign
Transcript: ENSMUST00000149236
SMART Domains Protein: ENSMUSP00000124117
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 7.9e-32 PFAM
Blast:VWA 352 408 2e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159780
AA Change: I846N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123727
Gene: ENSMUSG00000046613
AA Change: I846N

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 5.5e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231362
Predicted Effect probably benign
Transcript: ENSMUST00000231386
Predicted Effect probably benign
Transcript: ENSMUST00000231387
Predicted Effect probably benign
Transcript: ENSMUST00000231471
Predicted Effect probably benign
Transcript: ENSMUST00000231531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231608
Predicted Effect probably benign
Transcript: ENSMUST00000231749
Predicted Effect probably benign
Transcript: ENSMUST00000231904
Predicted Effect probably benign
Transcript: ENSMUST00000232319
Predicted Effect probably benign
Transcript: ENSMUST00000232451
Predicted Effect probably benign
Transcript: ENSMUST00000232458
Meta Mutation Damage Score 0.2363 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T A 16: 88,627,051 H184L probably benign Het
9230104L09Rik G T 2: 148,850,825 A19D probably damaging Het
Ccar1 A G 10: 62,764,533 Y540H probably damaging Het
Celf2 A G 2: 6,884,955 F2L probably benign Het
Cfap57 T C 4: 118,569,396 I1119V probably benign Het
Clec4f T C 6: 83,652,868 Q236R probably damaging Het
Cyp4a31 C T 4: 115,563,877 P54L probably damaging Het
Dapk1 T C 13: 60,761,326 V1251A probably benign Het
Dnah7b G A 1: 46,340,175 V3690M probably damaging Het
Dock9 A T 14: 121,605,243 M1K probably null Het
Emb T G 13: 117,249,130 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
F7 C T 8: 13,035,140 H389Y probably damaging Het
Fam111a T A 19: 12,586,902 I49K probably damaging Het
Fam50b T G 13: 34,746,669 S43A probably benign Het
Gbp7 A T 3: 142,546,498 Y614F probably benign Het
Gli3 T A 13: 15,724,732 D901E probably damaging Het
Hhatl C T 9: 121,788,225 probably null Het
Idua T A 5: 108,681,708 L432H probably benign Het
Ighv10-3 T A 12: 114,523,466 T112S possibly damaging Het
Kcnj6 T A 16: 94,762,601 D346V possibly damaging Het
Lrba A G 3: 86,348,357 D1002G probably benign Het
Lrrd1 T A 5: 3,850,629 S311R probably damaging Het
Mafk A G 5: 139,799,193 N4S probably benign Het
Mfsd14b T C 13: 65,095,686 Y48C probably damaging Het
Mindy3 C T 2: 12,356,933 A333T probably damaging Het
Mlxip G A 5: 123,394,952 C8Y probably benign Het
Mthfd1l A T 10: 3,980,234 M110L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Olfr128 T C 17: 37,923,794 V76A possibly damaging Het
Olfr366 A T 2: 37,220,124 I212F probably benign Het
Orc2 C A 1: 58,500,334 V49L probably benign Het
Pfkp C T 13: 6,585,250 probably benign Het
Pkd1l3 T C 8: 109,646,909 F1359S probably benign Het
Ralgps1 A T 2: 33,174,443 I222N probably damaging Het
Rrad T G 8: 104,629,860 E136A probably benign Het
Serpine3 T C 14: 62,664,981 S14P probably benign Het
Slc2a12 A G 10: 22,664,995 T250A probably benign Het
Slc4a5 T G 6: 83,226,374 F85L probably benign Het
Stx18 T A 5: 38,126,917 probably null Het
Tbcd T C 11: 121,497,086 S348P probably benign Het
Usp9y T C Y: 1,340,123 T1419A probably benign Homo
Vmn2r69 T C 7: 85,411,627 S250G probably benign Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Zfp74 A T 7: 29,937,987 Y33N probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Other mutations in Vwa5b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Vwa5b2 APN 16 20604270 missense probably benign
IGL01543:Vwa5b2 APN 16 20595716 missense probably benign 0.02
IGL01719:Vwa5b2 APN 16 20597433 critical splice donor site probably null
IGL02006:Vwa5b2 APN 16 20597093 missense probably damaging 0.97
IGL02150:Vwa5b2 APN 16 20604826 missense probably benign
IGL02301:Vwa5b2 APN 16 20604790 missense probably damaging 1.00
IGL02373:Vwa5b2 APN 16 20604844 missense probably damaging 0.99
IGL02413:Vwa5b2 APN 16 20598101 missense probably damaging 1.00
IGL02664:Vwa5b2 APN 16 20595313 unclassified probably benign
R1171:Vwa5b2 UTSW 16 20604984 missense probably benign
R1405:Vwa5b2 UTSW 16 20604316 missense probably benign 0.00
R1405:Vwa5b2 UTSW 16 20604316 missense probably benign 0.00
R1464:Vwa5b2 UTSW 16 20596269 missense probably benign 0.08
R1464:Vwa5b2 UTSW 16 20596269 missense probably benign 0.08
R1730:Vwa5b2 UTSW 16 20600925 missense probably damaging 1.00
R1901:Vwa5b2 UTSW 16 20604832 missense possibly damaging 0.77
R1902:Vwa5b2 UTSW 16 20604832 missense possibly damaging 0.77
R1903:Vwa5b2 UTSW 16 20604832 missense possibly damaging 0.77
R1959:Vwa5b2 UTSW 16 20602191 critical splice donor site probably null
R1961:Vwa5b2 UTSW 16 20602191 critical splice donor site probably null
R3522:Vwa5b2 UTSW 16 20601608 missense probably damaging 0.99
R3687:Vwa5b2 UTSW 16 20591558 unclassified probably benign
R3746:Vwa5b2 UTSW 16 20598326 intron probably benign
R3747:Vwa5b2 UTSW 16 20598326 intron probably benign
R3749:Vwa5b2 UTSW 16 20598326 intron probably benign
R3952:Vwa5b2 UTSW 16 20598361 makesense probably null
R4641:Vwa5b2 UTSW 16 20604643 missense probably damaging 1.00
R4646:Vwa5b2 UTSW 16 20596329 missense probably damaging 1.00
R4772:Vwa5b2 UTSW 16 20600803 splice site probably null
R5032:Vwa5b2 UTSW 16 20600709 missense probably damaging 1.00
R5286:Vwa5b2 UTSW 16 20596308 missense probably damaging 1.00
R5569:Vwa5b2 UTSW 16 20595339 missense probably damaging 1.00
R5585:Vwa5b2 UTSW 16 20594678 nonsense probably null
R5640:Vwa5b2 UTSW 16 20597542 missense probably damaging 1.00
R6459:Vwa5b2 UTSW 16 20594679 missense probably damaging 0.98
R6992:Vwa5b2 UTSW 16 20598202 missense probably damaging 1.00
R7102:Vwa5b2 UTSW 16 20604234 missense probably benign 0.00
R7231:Vwa5b2 UTSW 16 20604128 missense probably benign 0.00
R7591:Vwa5b2 UTSW 16 20601567 missense probably damaging 0.96
R7765:Vwa5b2 UTSW 16 20594611 missense probably benign
R8269:Vwa5b2 UTSW 16 20604438 missense probably damaging 1.00
R8311:Vwa5b2 UTSW 16 20591222 missense probably damaging 1.00
Z1176:Vwa5b2 UTSW 16 20591253 missense probably damaging 0.99
Z1177:Vwa5b2 UTSW 16 20600651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACGCTGGTTTTCTGACAC -3'
(R):5'- AGCTGTTCATTGTCCTGGAC -3'

Sequencing Primer
(F):5'- GAGCACAGTTCACCATGTTG -3'
(R):5'- ACCACAGAGGCTGCTGTCAG -3'
Posted On2018-04-02