Incidental Mutation 'R6330:Olfr128'
ID510879
Institutional Source Beutler Lab
Gene Symbol Olfr128
Ensembl Gene ENSMUSG00000059030
Gene Nameolfactory receptor 128
SynonymsMOR218-13, GA_x6K02T2PSCP-2374126-2375048
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6330 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37920548-37926801 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37923794 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 76 (V76A)
Ref Sequence ENSEMBL: ENSMUSP00000151065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080231] [ENSMUST00000216440]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080231
AA Change: V76A

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079121
Gene: ENSMUSG00000059030
AA Change: V76A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.1e-5 PFAM
Pfam:7tm_1 41 290 1.6e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216440
AA Change: V76A

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T A 16: 88,627,051 H184L probably benign Het
9230104L09Rik G T 2: 148,850,825 A19D probably damaging Het
Ccar1 A G 10: 62,764,533 Y540H probably damaging Het
Celf2 A G 2: 6,884,955 F2L probably benign Het
Cfap57 T C 4: 118,569,396 I1119V probably benign Het
Clec4f T C 6: 83,652,868 Q236R probably damaging Het
Cyp4a31 C T 4: 115,563,877 P54L probably damaging Het
Dapk1 T C 13: 60,761,326 V1251A probably benign Het
Dnah7b G A 1: 46,340,175 V3690M probably damaging Het
Dock9 A T 14: 121,605,243 M1K probably null Het
Emb T G 13: 117,249,130 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
F7 C T 8: 13,035,140 H389Y probably damaging Het
Fam111a T A 19: 12,586,902 I49K probably damaging Het
Fam50b T G 13: 34,746,669 S43A probably benign Het
Gbp7 A T 3: 142,546,498 Y614F probably benign Het
Gli3 T A 13: 15,724,732 D901E probably damaging Het
Hhatl C T 9: 121,788,225 probably null Het
Idua T A 5: 108,681,708 L432H probably benign Het
Ighv10-3 T A 12: 114,523,466 T112S possibly damaging Het
Kcnj6 T A 16: 94,762,601 D346V possibly damaging Het
Lrba A G 3: 86,348,357 D1002G probably benign Het
Lrrd1 T A 5: 3,850,629 S311R probably damaging Het
Mafk A G 5: 139,799,193 N4S probably benign Het
Mfsd14b T C 13: 65,095,686 Y48C probably damaging Het
Mindy3 C T 2: 12,356,933 A333T probably damaging Het
Mlxip G A 5: 123,394,952 C8Y probably benign Het
Mthfd1l A T 10: 3,980,234 M110L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Olfr366 A T 2: 37,220,124 I212F probably benign Het
Orc2 C A 1: 58,500,334 V49L probably benign Het
Pfkp C T 13: 6,585,250 probably benign Het
Pkd1l3 T C 8: 109,646,909 F1359S probably benign Het
Ralgps1 A T 2: 33,174,443 I222N probably damaging Het
Rrad T G 8: 104,629,860 E136A probably benign Het
Serpine3 T C 14: 62,664,981 S14P probably benign Het
Slc2a12 A G 10: 22,664,995 T250A probably benign Het
Slc4a5 T G 6: 83,226,374 F85L probably benign Het
Stx18 T A 5: 38,126,917 probably null Het
Tbcd T C 11: 121,497,086 S348P probably benign Het
Usp9y T C Y: 1,340,123 T1419A probably benign Homo
Vmn2r69 T C 7: 85,411,627 S250G probably benign Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Vwa5b2 T A 16: 20,601,977 I846N probably damaging Het
Zfp74 A T 7: 29,937,987 Y33N probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Other mutations in Olfr128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Olfr128 APN 17 37923959 missense possibly damaging 0.73
IGL01940:Olfr128 APN 17 37924286 missense probably damaging 1.00
R0427:Olfr128 UTSW 17 37923629 missense probably benign 0.00
R0462:Olfr128 UTSW 17 37923776 missense probably damaging 1.00
R0546:Olfr128 UTSW 17 37924338 nonsense probably null
R0760:Olfr128 UTSW 17 37924114 nonsense probably null
R0940:Olfr128 UTSW 17 37923700 missense probably damaging 0.98
R1898:Olfr128 UTSW 17 37923625 missense possibly damaging 0.91
R1935:Olfr128 UTSW 17 37924102 missense probably damaging 1.00
R2060:Olfr128 UTSW 17 37923880 missense probably benign 0.00
R4680:Olfr128 UTSW 17 37923922 missense probably damaging 1.00
R5165:Olfr128 UTSW 17 37924361 missense probably benign 0.14
R5526:Olfr128 UTSW 17 37924492 makesense probably null
R5594:Olfr128 UTSW 17 37923611 missense probably benign 0.00
R5751:Olfr128 UTSW 17 37923970 missense probably benign 0.44
R7123:Olfr128 UTSW 17 37923676 missense probably benign 0.33
R7354:Olfr128 UTSW 17 37924393 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATTCCTCCTCATGGGGTTC -3'
(R):5'- CCAAGTGCACTTTCTGGGAC -3'

Sequencing Primer
(F):5'- GGTTCTCTGACAACCATGAGCTG -3'
(R):5'- GGGACTCATTATGACCTCATAGTGC -3'
Posted On2018-04-02