Incidental Mutation 'R6331:Olfr1239'
ID510889
Institutional Source Beutler Lab
Gene Symbol Olfr1239
Ensembl Gene ENSMUSG00000075088
Gene Nameolfactory receptor 1239
SynonymsGA_x6K02T2Q125-50861284-50860367, MOR231-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6331 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89417030-89420407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89418351 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 21 (G21S)
Ref Sequence ENSEMBL: ENSMUSP00000149898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099780] [ENSMUST00000216762] [ENSMUST00000217181]
Predicted Effect probably benign
Transcript: ENSMUST00000099780
AA Change: G21S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097368
Gene: ENSMUSG00000075088
AA Change: G21S

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.5e-46 PFAM
Pfam:7tm_1 39 285 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216762
AA Change: G21S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000217181
AA Change: G21S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,180,514 R228H probably damaging Het
9930021J03Rik C T 19: 29,717,747 V1449I probably benign Het
A2ml1 T C 6: 128,552,236 D981G probably damaging Het
Abcc1 C A 16: 14,465,056 A1132D probably damaging Het
Adamts12 A G 15: 11,241,433 T364A probably damaging Het
Ahnak A T 19: 9,006,625 M1758L probably benign Het
Ak9 T C 10: 41,382,829 V774A probably damaging Het
Ash1l A G 3: 89,007,865 E1934G probably benign Het
Atp2b2 C T 6: 113,797,131 A341T probably benign Het
Bach2 G T 4: 32,238,816 probably benign Het
Ccdc102a T C 8: 94,911,516 T241A probably benign Het
Chd5 G T 4: 152,382,408 R1627S probably benign Het
Clint1 T C 11: 45,895,081 S322P probably benign Het
Dapk1 T A 13: 60,729,442 C498* probably null Het
Diaph3 T G 14: 86,866,540 S803R probably damaging Het
Dmp1 T C 5: 104,207,125 L10P probably damaging Het
Gcc2 T C 10: 58,271,465 V741A probably benign Het
Gldn A G 9: 54,286,878 M119V probably benign Het
Gucy1b1 A G 3: 82,034,411 S574P possibly damaging Het
Hapln4 T A 8: 70,084,423 probably benign Het
Hars A G 18: 36,771,332 V209A probably benign Het
Htt T A 5: 34,895,887 F2521L possibly damaging Het
Kif14 A G 1: 136,515,986 D1299G probably null Het
Krt25 T A 11: 99,317,427 E325V probably damaging Het
Lcmt1 T C 7: 123,378,182 probably benign Het
Lrp1b A T 2: 40,803,209 N3266K probably damaging Het
Marc2 A G 1: 184,819,328 S304P probably damaging Het
Mctp1 T A 13: 77,020,863 probably null Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Myom3 A G 4: 135,776,377 N379S possibly damaging Het
Nbea A T 3: 56,000,616 D1358E possibly damaging Het
Nod1 T C 6: 54,924,983 E939G probably damaging Het
Obox1 A G 7: 15,555,369 R70G probably benign Het
Olfr1024 T C 2: 85,904,216 I279M probably benign Het
Olfr1341 A G 4: 118,709,947 E180G probably benign Het
Olfr272 A G 4: 52,911,399 Y132H probably damaging Het
Otof T C 5: 30,371,935 D1745G possibly damaging Het
Pklr A G 3: 89,137,355 I47V probably damaging Het
Pms2 T A 5: 143,914,633 S123T possibly damaging Het
Pnpla2 T C 7: 141,459,285 S337P probably damaging Het
Ptgfrn A C 3: 101,045,620 V766G possibly damaging Het
Ptpn11 T A 5: 121,144,653 H419L probably damaging Het
Rims3 T A 4: 120,883,153 V99E probably damaging Het
Samd9l A G 6: 3,376,361 V300A probably damaging Het
Sdad1 T C 5: 92,303,930 D144G probably damaging Het
Siglecg T C 7: 43,408,754 Y22H possibly damaging Het
Slc39a1 A G 3: 90,252,281 K305R possibly damaging Het
Slc5a4a A G 10: 76,178,200 R414G probably damaging Het
Smg1 T C 7: 118,154,277 probably benign Het
Tbc1d9b C T 11: 50,131,497 A20V possibly damaging Het
Tgfb3 G T 12: 86,063,864 D237E probably benign Het
Tle6 A G 10: 81,595,239 S234P probably benign Het
Tnrc6b A G 15: 80,879,614 N439S probably benign Het
Trim33 T C 3: 103,341,609 S783P probably benign Het
Ttn A T 2: 76,802,354 Y12373N probably damaging Het
Tube1 G A 10: 39,134,101 V7I probably benign Het
Tufm T C 7: 126,489,238 V265A probably benign Het
Uhrf1bp1 T C 17: 27,893,201 I1150T probably benign Het
Usp32 T C 11: 84,986,576 H1550R possibly damaging Het
Usp33 A T 3: 152,376,250 M546L probably damaging Het
Uspl1 C A 5: 149,214,287 Q752K probably benign Het
Vmn1r20 A G 6: 57,431,670 probably null Het
Vmn1r201 T C 13: 22,475,351 F245S probably damaging Het
Vmn2r3 A G 3: 64,278,761 S168P probably damaging Het
Wdr24 T G 17: 25,825,676 D168E possibly damaging Het
Zfp646 C T 7: 127,883,681 P1677S probably damaging Het
Other mutations in Olfr1239
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03186:Olfr1239 APN 2 89417844 missense probably damaging 0.99
PIT4810001:Olfr1239 UTSW 2 89417953 missense probably damaging 1.00
R0271:Olfr1239 UTSW 2 89418158 missense probably benign 0.00
R0521:Olfr1239 UTSW 2 89418200 missense probably damaging 1.00
R0667:Olfr1239 UTSW 2 89417688 missense probably benign 0.05
R1738:Olfr1239 UTSW 2 89418018 missense probably benign 0.02
R1955:Olfr1239 UTSW 2 89418411 start codon destroyed probably damaging 1.00
R3114:Olfr1239 UTSW 2 89418413 unclassified probably null
R4110:Olfr1239 UTSW 2 89418100 missense probably benign 0.01
R4111:Olfr1239 UTSW 2 89418100 missense probably benign 0.01
R4796:Olfr1239 UTSW 2 89417891 missense probably damaging 0.99
R4951:Olfr1239 UTSW 2 89417772 missense probably benign 0.01
R5751:Olfr1239 UTSW 2 89417687 missense probably damaging 1.00
R7249:Olfr1239 UTSW 2 89417873 missense probably damaging 1.00
R7352:Olfr1239 UTSW 2 89417967 missense probably damaging 1.00
R7476:Olfr1239 UTSW 2 89417499 missense possibly damaging 0.69
R7493:Olfr1239 UTSW 2 89417801 missense probably benign 0.08
R7589:Olfr1239 UTSW 2 89418380 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGTGTAACTGTGGTTGAATACAC -3'
(R):5'- TGTAACACCATTGAATTTGGAGACTCC -3'

Sequencing Primer
(F):5'- CTGTGGTTGAATACACAGCATCC -3'
(R):5'- CCATTGAATTTGGAGACTCCTATTTG -3'
Posted On2018-04-02