Incidental Mutation 'R6331:Ptgfrn'
ID 510896
Institutional Source Beutler Lab
Gene Symbol Ptgfrn
Ensembl Gene ENSMUSG00000027864
Gene Name prostaglandin F2 receptor negative regulator
Synonyms CD9P-1, 4833445A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6331 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 101040232-101110278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 101045620 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 766 (V766G)
Ref Sequence ENSEMBL: ENSMUSP00000099755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102694]
AlphaFold Q9WV91
Predicted Effect possibly damaging
Transcript: ENSMUST00000102694
AA Change: V766G

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: V766G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 38 121 3.01e-7 SMART
IG 154 264 1.54e-4 SMART
IG 284 390 1.11e-5 SMART
IG 414 532 1.72e-2 SMART
IG 556 676 9.71e-2 SMART
IG 696 822 5.21e-2 SMART
transmembrane domain 831 853 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,180,514 R228H probably damaging Het
9930021J03Rik C T 19: 29,717,747 V1449I probably benign Het
A2ml1 T C 6: 128,552,236 D981G probably damaging Het
Abcc1 C A 16: 14,465,056 A1132D probably damaging Het
Adamts12 A G 15: 11,241,433 T364A probably damaging Het
Ahnak A T 19: 9,006,625 M1758L probably benign Het
Ak9 T C 10: 41,382,829 V774A probably damaging Het
Ash1l A G 3: 89,007,865 E1934G probably benign Het
Atp2b2 C T 6: 113,797,131 A341T probably benign Het
Bach2 G T 4: 32,238,816 probably benign Het
Ccdc102a T C 8: 94,911,516 T241A probably benign Het
Chd5 G T 4: 152,382,408 R1627S probably benign Het
Clint1 T C 11: 45,895,081 S322P probably benign Het
Dapk1 T A 13: 60,729,442 C498* probably null Het
Diaph3 T G 14: 86,866,540 S803R probably damaging Het
Dmp1 T C 5: 104,207,125 L10P probably damaging Het
Gcc2 T C 10: 58,271,465 V741A probably benign Het
Gldn A G 9: 54,286,878 M119V probably benign Het
Gucy1b1 A G 3: 82,034,411 S574P possibly damaging Het
Hapln4 T A 8: 70,084,423 probably benign Het
Hars A G 18: 36,771,332 V209A probably benign Het
Htt T A 5: 34,895,887 F2521L possibly damaging Het
Kif14 A G 1: 136,515,986 D1299G probably null Het
Krt25 T A 11: 99,317,427 E325V probably damaging Het
Lcmt1 T C 7: 123,378,182 probably benign Het
Lrp1b A T 2: 40,803,209 N3266K probably damaging Het
Marc2 A G 1: 184,819,328 S304P probably damaging Het
Mctp1 T A 13: 77,020,863 probably null Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Myom3 A G 4: 135,776,377 N379S possibly damaging Het
Nbea A T 3: 56,000,616 D1358E possibly damaging Het
Nod1 T C 6: 54,924,983 E939G probably damaging Het
Obox1 A G 7: 15,555,369 R70G probably benign Het
Olfr1024 T C 2: 85,904,216 I279M probably benign Het
Olfr1239 C T 2: 89,418,351 G21S probably benign Het
Olfr1341 A G 4: 118,709,947 E180G probably benign Het
Olfr272 A G 4: 52,911,399 Y132H probably damaging Het
Otof T C 5: 30,371,935 D1745G possibly damaging Het
Pklr A G 3: 89,137,355 I47V probably damaging Het
Pms2 T A 5: 143,914,633 S123T possibly damaging Het
Pnpla2 T C 7: 141,459,285 S337P probably damaging Het
Ptpn11 T A 5: 121,144,653 H419L probably damaging Het
Rims3 T A 4: 120,883,153 V99E probably damaging Het
Samd9l A G 6: 3,376,361 V300A probably damaging Het
Sdad1 T C 5: 92,303,930 D144G probably damaging Het
Siglecg T C 7: 43,408,754 Y22H possibly damaging Het
Slc39a1 A G 3: 90,252,281 K305R possibly damaging Het
Slc5a4a A G 10: 76,178,200 R414G probably damaging Het
Smg1 T C 7: 118,154,277 probably benign Het
Tbc1d9b C T 11: 50,131,497 A20V possibly damaging Het
Tgfb3 G T 12: 86,063,864 D237E probably benign Het
Tle6 A G 10: 81,595,239 S234P probably benign Het
Tnrc6b A G 15: 80,879,614 N439S probably benign Het
Trim33 T C 3: 103,341,609 S783P probably benign Het
Ttn A T 2: 76,802,354 Y12373N probably damaging Het
Tube1 G A 10: 39,134,101 V7I probably benign Het
Tufm T C 7: 126,489,238 V265A probably benign Het
Uhrf1bp1 T C 17: 27,893,201 I1150T probably benign Het
Usp32 T C 11: 84,986,576 H1550R possibly damaging Het
Usp33 A T 3: 152,376,250 M546L probably damaging Het
Uspl1 C A 5: 149,214,287 Q752K probably benign Het
Vmn1r20 A G 6: 57,431,670 probably null Het
Vmn1r201 T C 13: 22,475,351 F245S probably damaging Het
Vmn2r3 A G 3: 64,278,761 S168P probably damaging Het
Wdr24 T G 17: 25,825,676 D168E possibly damaging Het
Zfp646 C T 7: 127,883,681 P1677S probably damaging Het
Other mutations in Ptgfrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ptgfrn APN 3 101072845 missense probably benign 0.01
IGL01710:Ptgfrn APN 3 101073088 missense probably damaging 0.98
IGL02557:Ptgfrn APN 3 101060636 critical splice donor site probably null
IGL02740:Ptgfrn APN 3 101072937 missense possibly damaging 0.84
IGL02817:Ptgfrn APN 3 101060752 missense probably benign
IGL02948:Ptgfrn APN 3 101072819 missense probably benign 0.21
R1540:Ptgfrn UTSW 3 101060654 missense probably benign 0.41
R1563:Ptgfrn UTSW 3 101060651 missense possibly damaging 0.67
R1730:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1766:Ptgfrn UTSW 3 101050122 missense probably benign 0.00
R1783:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1918:Ptgfrn UTSW 3 101056307 missense probably benign
R2113:Ptgfrn UTSW 3 101077309 missense probably benign 0.00
R2290:Ptgfrn UTSW 3 101077361 missense possibly damaging 0.77
R3522:Ptgfrn UTSW 3 101043402 missense probably damaging 1.00
R5223:Ptgfrn UTSW 3 101045593 missense probably benign 0.13
R5600:Ptgfrn UTSW 3 101056250 missense probably damaging 0.99
R5642:Ptgfrn UTSW 3 101043362 missense probably damaging 1.00
R5927:Ptgfrn UTSW 3 101060652 missense possibly damaging 0.92
R5984:Ptgfrn UTSW 3 101050143 missense probably damaging 0.99
R6124:Ptgfrn UTSW 3 101073089 missense probably damaging 0.98
R6363:Ptgfrn UTSW 3 101045578 missense possibly damaging 0.93
R6473:Ptgfrn UTSW 3 101045639 missense probably damaging 1.00
R6856:Ptgfrn UTSW 3 101045446 missense probably damaging 1.00
R7151:Ptgfrn UTSW 3 101080195 nonsense probably null
R7313:Ptgfrn UTSW 3 101073047 missense possibly damaging 0.84
R7361:Ptgfrn UTSW 3 101077444 missense probably benign 0.03
R7806:Ptgfrn UTSW 3 101077132 missense possibly damaging 0.50
R7823:Ptgfrn UTSW 3 101043409 missense probably damaging 1.00
R7841:Ptgfrn UTSW 3 101060810 missense probably damaging 0.98
R8093:Ptgfrn UTSW 3 101056437 missense probably benign 0.19
R8093:Ptgfrn UTSW 3 101072941 missense probably benign 0.09
R8490:Ptgfrn UTSW 3 101056370 missense probably damaging 0.99
R8856:Ptgfrn UTSW 3 101056611 missense possibly damaging 0.86
Z1088:Ptgfrn UTSW 3 101056437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTACAACTCGGGAAG -3'
(R):5'- AGCGTGTACATCGTTTCTGC -3'

Sequencing Primer
(F):5'- CTCGGGAAGATACTTAGATACCCAG -3'
(R):5'- GCTCACACTCTGACCTCAG -3'
Posted On 2018-04-02