Mutagenetix > Incidental Mutations

Incidental Mutation 'R6331:Ptgfrn'

510896

Institutional Source

Beutler Lab

Gene Symbol

Ptgfrn

Ensembl Gene

ENSMUSG00000027864

Gene Name

prostaglandin F2 receptor negative regulator

Synonyms

CD9P-1, 4833445A08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6331 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101040232-101110278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 101045620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 766 (V766G)

Ref Sequence

ENSEMBL: ENSMUSP00000099755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102694]

AlphaFold

Q9WV91

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102694
AA Change: V766G

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: V766G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGv	38	121	3.01e-7	SMART
IG	154	264	1.54e-4	SMART
IG	284	390	1.11e-5	SMART
IG	414	532	1.72e-2	SMART
IG	556	676	9.71e-2	SMART
IG	696	822	5.21e-2	SMART
transmembrane domain	831	853	N/A	INTRINSIC
low complexity region	862	872	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

100% (66/66)

MGI Phenotype

PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	G	A	18: 12,180,514	R228H	probably damaging	Het
9930021J03Rik	C	T	19: 29,717,747	V1449I	probably benign	Het
A2ml1	T	C	6: 128,552,236	D981G	probably damaging	Het
Abcc1	C	A	16: 14,465,056	A1132D	probably damaging	Het
Adamts12	A	G	15: 11,241,433	T364A	probably damaging	Het
Ahnak	A	T	19: 9,006,625	M1758L	probably benign	Het
Ak9	T	C	10: 41,382,829	V774A	probably damaging	Het
Ash1l	A	G	3: 89,007,865	E1934G	probably benign	Het
Atp2b2	C	T	6: 113,797,131	A341T	probably benign	Het
Bach2	G	T	4: 32,238,816		probably benign	Het
Ccdc102a	T	C	8: 94,911,516	T241A	probably benign	Het
Chd5	G	T	4: 152,382,408	R1627S	probably benign	Het
Clint1	T	C	11: 45,895,081	S322P	probably benign	Het
Dapk1	T	A	13: 60,729,442	C498*	probably null	Het
Diaph3	T	G	14: 86,866,540	S803R	probably damaging	Het
Dmp1	T	C	5: 104,207,125	L10P	probably damaging	Het
Gcc2	T	C	10: 58,271,465	V741A	probably benign	Het
Gldn	A	G	9: 54,286,878	M119V	probably benign	Het
Gucy1b1	A	G	3: 82,034,411	S574P	possibly damaging	Het
Hapln4	T	A	8: 70,084,423		probably benign	Het
Hars	A	G	18: 36,771,332	V209A	probably benign	Het
Htt	T	A	5: 34,895,887	F2521L	possibly damaging	Het
Kif14	A	G	1: 136,515,986	D1299G	probably null	Het
Krt25	T	A	11: 99,317,427	E325V	probably damaging	Het
Lcmt1	T	C	7: 123,378,182		probably benign	Het
Lrp1b	A	T	2: 40,803,209	N3266K	probably damaging	Het
Marc2	A	G	1: 184,819,328	S304P	probably damaging	Het
Mctp1	T	A	13: 77,020,863		probably null	Het
Myo5b	G	A	18: 74,616,993	A176T	probably damaging	Het
Myom3	A	G	4: 135,776,377	N379S	possibly damaging	Het
Nbea	A	T	3: 56,000,616	D1358E	possibly damaging	Het
Nod1	T	C	6: 54,924,983	E939G	probably damaging	Het
Obox1	A	G	7: 15,555,369	R70G	probably benign	Het
Olfr1024	T	C	2: 85,904,216	I279M	probably benign	Het
Olfr1239	C	T	2: 89,418,351	G21S	probably benign	Het
Olfr1341	A	G	4: 118,709,947	E180G	probably benign	Het
Olfr272	A	G	4: 52,911,399	Y132H	probably damaging	Het
Otof	T	C	5: 30,371,935	D1745G	possibly damaging	Het
Pklr	A	G	3: 89,137,355	I47V	probably damaging	Het
Pms2	T	A	5: 143,914,633	S123T	possibly damaging	Het
Pnpla2	T	C	7: 141,459,285	S337P	probably damaging	Het
Ptpn11	T	A	5: 121,144,653	H419L	probably damaging	Het
Rims3	T	A	4: 120,883,153	V99E	probably damaging	Het
Samd9l	A	G	6: 3,376,361	V300A	probably damaging	Het
Sdad1	T	C	5: 92,303,930	D144G	probably damaging	Het
Siglecg	T	C	7: 43,408,754	Y22H	possibly damaging	Het
Slc39a1	A	G	3: 90,252,281	K305R	possibly damaging	Het
Slc5a4a	A	G	10: 76,178,200	R414G	probably damaging	Het
Smg1	T	C	7: 118,154,277		probably benign	Het
Tbc1d9b	C	T	11: 50,131,497	A20V	possibly damaging	Het
Tgfb3	G	T	12: 86,063,864	D237E	probably benign	Het
Tle6	A	G	10: 81,595,239	S234P	probably benign	Het
Tnrc6b	A	G	15: 80,879,614	N439S	probably benign	Het
Trim33	T	C	3: 103,341,609	S783P	probably benign	Het
Ttn	A	T	2: 76,802,354	Y12373N	probably damaging	Het
Tube1	G	A	10: 39,134,101	V7I	probably benign	Het
Tufm	T	C	7: 126,489,238	V265A	probably benign	Het
Uhrf1bp1	T	C	17: 27,893,201	I1150T	probably benign	Het
Usp32	T	C	11: 84,986,576	H1550R	possibly damaging	Het
Usp33	A	T	3: 152,376,250	M546L	probably damaging	Het
Uspl1	C	A	5: 149,214,287	Q752K	probably benign	Het
Vmn1r20	A	G	6: 57,431,670		probably null	Het
Vmn1r201	T	C	13: 22,475,351	F245S	probably damaging	Het
Vmn2r3	A	G	3: 64,278,761	S168P	probably damaging	Het
Wdr24	T	G	17: 25,825,676	D168E	possibly damaging	Het
Zfp646	C	T	7: 127,883,681	P1677S	probably damaging	Het

Other mutations in Ptgfrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ptgfrn	APN	3	101072845	missense	probably benign	0.01
IGL01710:Ptgfrn	APN	3	101073088	missense	probably damaging	0.98
IGL02557:Ptgfrn	APN	3	101060636	critical splice donor site	probably null
IGL02740:Ptgfrn	APN	3	101072937	missense	possibly damaging	0.84
IGL02817:Ptgfrn	APN	3	101060752	missense	probably benign
IGL02948:Ptgfrn	APN	3	101072819	missense	probably benign	0.21
R1540:Ptgfrn	UTSW	3	101060654	missense	probably benign	0.41
R1563:Ptgfrn	UTSW	3	101060651	missense	possibly damaging	0.67
R1730:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1766:Ptgfrn	UTSW	3	101050122	missense	probably benign	0.00
R1783:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1918:Ptgfrn	UTSW	3	101056307	missense	probably benign
R2113:Ptgfrn	UTSW	3	101077309	missense	probably benign	0.00
R2290:Ptgfrn	UTSW	3	101077361	missense	possibly damaging	0.77
R3522:Ptgfrn	UTSW	3	101043402	missense	probably damaging	1.00
R5223:Ptgfrn	UTSW	3	101045593	missense	probably benign	0.13
R5600:Ptgfrn	UTSW	3	101056250	missense	probably damaging	0.99
R5642:Ptgfrn	UTSW	3	101043362	missense	probably damaging	1.00
R5927:Ptgfrn	UTSW	3	101060652	missense	possibly damaging	0.92
R5984:Ptgfrn	UTSW	3	101050143	missense	probably damaging	0.99
R6124:Ptgfrn	UTSW	3	101073089	missense	probably damaging	0.98
R6363:Ptgfrn	UTSW	3	101045578	missense	possibly damaging	0.93
R6473:Ptgfrn	UTSW	3	101045639	missense	probably damaging	1.00
R6856:Ptgfrn	UTSW	3	101045446	missense	probably damaging	1.00
R7151:Ptgfrn	UTSW	3	101080195	nonsense	probably null
R7313:Ptgfrn	UTSW	3	101073047	missense	possibly damaging	0.84
R7361:Ptgfrn	UTSW	3	101077444	missense	probably benign	0.03
R7806:Ptgfrn	UTSW	3	101077132	missense	possibly damaging	0.50
R7823:Ptgfrn	UTSW	3	101043409	missense	probably damaging	1.00
R7841:Ptgfrn	UTSW	3	101060810	missense	probably damaging	0.98
R8093:Ptgfrn	UTSW	3	101056437	missense	probably benign	0.19
R8093:Ptgfrn	UTSW	3	101072941	missense	probably benign	0.09
R8490:Ptgfrn	UTSW	3	101056370	missense	probably damaging	0.99
R8856:Ptgfrn	UTSW	3	101056611	missense	possibly damaging	0.86
Z1088:Ptgfrn	UTSW	3	101056437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGTACAACTCGGGAAG -3'
(R):5'- AGCGTGTACATCGTTTCTGC -3'

Sequencing Primer
(F):5'- CTCGGGAAGATACTTAGATACCCAG -3'
(R):5'- GCTCACACTCTGACCTCAG -3'

Posted On

2018-04-02