Incidental Mutation 'R6331:Otof'
ID510905
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Nameotoferlin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R6331 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location30367062-30461932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30371935 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1745 (D1745G)
Ref Sequence ENSEMBL: ENSMUSP00000110395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074171
AA Change: D1750G

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: D1750G

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114747
AA Change: D1745G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: D1745G

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Meta Mutation Damage Score 0.1408 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,180,514 R228H probably damaging Het
9930021J03Rik C T 19: 29,717,747 V1449I probably benign Het
A2ml1 T C 6: 128,552,236 D981G probably damaging Het
Abcc1 C A 16: 14,465,056 A1132D probably damaging Het
Adamts12 A G 15: 11,241,433 T364A probably damaging Het
Ahnak A T 19: 9,006,625 M1758L probably benign Het
Ak9 T C 10: 41,382,829 V774A probably damaging Het
Ash1l A G 3: 89,007,865 E1934G probably benign Het
Atp2b2 C T 6: 113,797,131 A341T probably benign Het
Bach2 G T 4: 32,238,816 probably benign Het
Ccdc102a T C 8: 94,911,516 T241A probably benign Het
Chd5 G T 4: 152,382,408 R1627S probably benign Het
Clint1 T C 11: 45,895,081 S322P probably benign Het
Dapk1 T A 13: 60,729,442 C498* probably null Het
Diaph3 T G 14: 86,866,540 S803R probably damaging Het
Dmp1 T C 5: 104,207,125 L10P probably damaging Het
Gcc2 T C 10: 58,271,465 V741A probably benign Het
Gldn A G 9: 54,286,878 M119V probably benign Het
Gucy1b1 A G 3: 82,034,411 S574P possibly damaging Het
Hapln4 T A 8: 70,084,423 probably benign Het
Hars A G 18: 36,771,332 V209A probably benign Het
Htt T A 5: 34,895,887 F2521L possibly damaging Het
Kif14 A G 1: 136,515,986 D1299G probably null Het
Krt25 T A 11: 99,317,427 E325V probably damaging Het
Lcmt1 T C 7: 123,378,182 probably benign Het
Lrp1b A T 2: 40,803,209 N3266K probably damaging Het
Marc2 A G 1: 184,819,328 S304P probably damaging Het
Mctp1 T A 13: 77,020,863 probably null Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Myom3 A G 4: 135,776,377 N379S possibly damaging Het
Nbea A T 3: 56,000,616 D1358E possibly damaging Het
Nod1 T C 6: 54,924,983 E939G probably damaging Het
Obox1 A G 7: 15,555,369 R70G probably benign Het
Olfr1024 T C 2: 85,904,216 I279M probably benign Het
Olfr1239 C T 2: 89,418,351 G21S probably benign Het
Olfr1341 A G 4: 118,709,947 E180G probably benign Het
Olfr272 A G 4: 52,911,399 Y132H probably damaging Het
Pklr A G 3: 89,137,355 I47V probably damaging Het
Pms2 T A 5: 143,914,633 S123T possibly damaging Het
Pnpla2 T C 7: 141,459,285 S337P probably damaging Het
Ptgfrn A C 3: 101,045,620 V766G possibly damaging Het
Ptpn11 T A 5: 121,144,653 H419L probably damaging Het
Rims3 T A 4: 120,883,153 V99E probably damaging Het
Samd9l A G 6: 3,376,361 V300A probably damaging Het
Sdad1 T C 5: 92,303,930 D144G probably damaging Het
Siglecg T C 7: 43,408,754 Y22H possibly damaging Het
Slc39a1 A G 3: 90,252,281 K305R possibly damaging Het
Slc5a4a A G 10: 76,178,200 R414G probably damaging Het
Smg1 T C 7: 118,154,277 probably benign Het
Tbc1d9b C T 11: 50,131,497 A20V possibly damaging Het
Tgfb3 G T 12: 86,063,864 D237E probably benign Het
Tle6 A G 10: 81,595,239 S234P probably benign Het
Tnrc6b A G 15: 80,879,614 N439S probably benign Het
Trim33 T C 3: 103,341,609 S783P probably benign Het
Ttn A T 2: 76,802,354 Y12373N probably damaging Het
Tube1 G A 10: 39,134,101 V7I probably benign Het
Tufm T C 7: 126,489,238 V265A probably benign Het
Uhrf1bp1 T C 17: 27,893,201 I1150T probably benign Het
Usp32 T C 11: 84,986,576 H1550R possibly damaging Het
Usp33 A T 3: 152,376,250 M546L probably damaging Het
Uspl1 C A 5: 149,214,287 Q752K probably benign Het
Vmn1r20 A G 6: 57,431,670 probably null Het
Vmn1r201 T C 13: 22,475,351 F245S probably damaging Het
Vmn2r3 A G 3: 64,278,761 S168P probably damaging Het
Wdr24 T G 17: 25,825,676 D168E possibly damaging Het
Zfp646 C T 7: 127,883,681 P1677S probably damaging Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30375904 missense probably damaging 1.00
IGL00391:Otof APN 5 30375623 missense probably damaging 1.00
IGL00579:Otof APN 5 30399322 missense possibly damaging 0.88
IGL00671:Otof APN 5 30385753 critical splice donor site probably null
IGL01019:Otof APN 5 30405216 missense probably benign 0.01
IGL01025:Otof APN 5 30384253 missense possibly damaging 0.82
IGL01086:Otof APN 5 30376273 critical splice donor site probably null
IGL01110:Otof APN 5 30461725 missense probably damaging 1.00
IGL01160:Otof APN 5 30381535 missense probably benign 0.00
IGL01285:Otof APN 5 30405183 missense probably damaging 1.00
IGL01329:Otof APN 5 30441379 missense probably benign 0.00
IGL01337:Otof APN 5 30405777 missense possibly damaging 0.93
IGL01337:Otof APN 5 30419512 missense probably benign 0.17
IGL01834:Otof APN 5 30399220 missense probably damaging 1.00
IGL01872:Otof APN 5 30379254 splice site probably benign
IGL01969:Otof APN 5 30382483 splice site probably benign
IGL02075:Otof APN 5 30370726 missense probably benign 0.23
IGL02077:Otof APN 5 30399235 missense probably damaging 1.00
IGL02136:Otof APN 5 30373992 missense possibly damaging 0.90
IGL02227:Otof APN 5 30370784 missense probably damaging 1.00
IGL02475:Otof APN 5 30376682 missense probably damaging 1.00
IGL02812:Otof APN 5 30374082 missense probably benign 0.08
IGL02864:Otof APN 5 30386341 missense probably damaging 0.99
IGL03176:Otof APN 5 30405176 splice site probably null
R0285:Otof UTSW 5 30379533 critical splice donor site probably null
R0421:Otof UTSW 5 30371568 missense possibly damaging 0.94
R0570:Otof UTSW 5 30371881 splice site probably benign
R0599:Otof UTSW 5 30370705 missense probably damaging 1.00
R0675:Otof UTSW 5 30382361 missense probably benign 0.01
R0715:Otof UTSW 5 30394697 missense probably damaging 0.99
R1019:Otof UTSW 5 30370743 missense probably damaging 0.96
R1183:Otof UTSW 5 30371912 missense probably damaging 1.00
R1435:Otof UTSW 5 30378695 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1474:Otof UTSW 5 30379532 critical splice donor site probably null
R1524:Otof UTSW 5 30379556 missense probably benign 0.03
R1563:Otof UTSW 5 30371005 missense probably benign 0.00
R1732:Otof UTSW 5 30386471 missense probably damaging 1.00
R1822:Otof UTSW 5 30378710 missense probably benign 0.00
R1845:Otof UTSW 5 30371723 nonsense probably null
R1925:Otof UTSW 5 30394188 missense probably benign 0.37
R1938:Otof UTSW 5 30376369 missense probably benign 0.00
R1968:Otof UTSW 5 30388654 missense probably damaging 1.00
R1996:Otof UTSW 5 30421037 missense probably benign 0.01
R1999:Otof UTSW 5 30388772 missense probably benign 0.19
R2027:Otof UTSW 5 30421014 missense probably benign 0.08
R2138:Otof UTSW 5 30461770 missense probably benign 0.01
R2173:Otof UTSW 5 30386374 missense probably damaging 1.00
R2245:Otof UTSW 5 30370207 missense probably damaging 1.00
R3011:Otof UTSW 5 30382840 missense probably damaging 1.00
R3105:Otof UTSW 5 30381801 missense probably benign 0.03
R3442:Otof UTSW 5 30371689 missense probably damaging 1.00
R3710:Otof UTSW 5 30385266 missense probably benign
R3715:Otof UTSW 5 30376871 nonsense probably null
R3806:Otof UTSW 5 30386499 critical splice acceptor site probably null
R3975:Otof UTSW 5 30370712 missense probably damaging 1.00
R4067:Otof UTSW 5 30399291 missense probably damaging 1.00
R4077:Otof UTSW 5 30419506 missense possibly damaging 0.89
R4166:Otof UTSW 5 30382418 missense probably damaging 1.00
R4451:Otof UTSW 5 30385164 missense possibly damaging 0.77
R4485:Otof UTSW 5 30375000 missense possibly damaging 0.77
R4600:Otof UTSW 5 30371900 missense probably damaging 1.00
R4646:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4648:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4669:Otof UTSW 5 30420974 critical splice donor site probably null
R4773:Otof UTSW 5 30394682 missense probably benign 0.05
R4839:Otof UTSW 5 30419404 missense probably damaging 0.99
R4907:Otof UTSW 5 30378661 critical splice donor site probably null
R4961:Otof UTSW 5 30383493 intron probably benign
R4991:Otof UTSW 5 30394181 missense probably damaging 1.00
R5015:Otof UTSW 5 30382894 missense probably damaging 1.00
R5036:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5038:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5253:Otof UTSW 5 30370139 missense probably damaging 1.00
R5336:Otof UTSW 5 30376720 missense probably benign 0.01
R5365:Otof UTSW 5 30381800 missense probably damaging 0.99
R5901:Otof UTSW 5 30374979 missense probably damaging 1.00
R6211:Otof UTSW 5 30371900 missense probably damaging 0.99
R6318:Otof UTSW 5 30414544 missense probably damaging 1.00
R6671:Otof UTSW 5 30419533 missense probably benign
R6701:Otof UTSW 5 30370797 nonsense probably null
R6792:Otof UTSW 5 30375634 missense probably damaging 1.00
R6853:Otof UTSW 5 30388239 missense probably damaging 1.00
R6940:Otof UTSW 5 30371643 missense probably damaging 0.96
R7037:Otof UTSW 5 30381538 missense probably benign 0.32
R7060:Otof UTSW 5 30388356 missense possibly damaging 0.84
R7089:Otof UTSW 5 30371568 missense possibly damaging 0.94
R7165:Otof UTSW 5 30375620 missense probably damaging 0.99
R7178:Otof UTSW 5 30383534 missense possibly damaging 0.50
R7298:Otof UTSW 5 30388270 missense probably damaging 1.00
R7393:Otof UTSW 5 30370270 missense probably benign 0.45
R7397:Otof UTSW 5 30375707 missense probably damaging 1.00
R7400:Otof UTSW 5 30385188 missense probably benign 0.04
R7428:Otof UTSW 5 30389825 missense probably damaging 1.00
R7456:Otof UTSW 5 30394661 missense probably damaging 1.00
R7505:Otof UTSW 5 30371020 missense probably benign 0.00
R7714:Otof UTSW 5 30370253 missense probably damaging 0.99
R8002:Otof UTSW 5 30380610 missense not run
R8032:Otof UTSW 5 30461798 start codon destroyed not run
Z1176:Otof UTSW 5 30371586 missense not run
Z1177:Otof UTSW 5 30376297 missense not run
Z1177:Otof UTSW 5 30383658 missense not run
Predicted Primers PCR Primer
(F):5'- ATCTCCAGTTGAAGTTGCCCTC -3'
(R):5'- ACTCAAGACTACCAGGGCTTC -3'

Sequencing Primer
(F):5'- TGAAGTTGCCCTCCCCCG -3'
(R):5'- GGCTTCTCTTGCTAGCACATAAGAG -3'
Posted On2018-04-02