Incidental Mutation 'R6331:Sdad1'
ID510907
Institutional Source Beutler Lab
Gene Symbol Sdad1
Ensembl Gene ENSMUSG00000029415
Gene NameSDA1 domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6331 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92284010-92310479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92303930 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 144 (D144G)
Ref Sequence ENSEMBL: ENSMUSP00000144446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031364] [ENSMUST00000201143] [ENSMUST00000202870]
Predicted Effect probably damaging
Transcript: ENSMUST00000031364
AA Change: D144G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031364
Gene: ENSMUSG00000029415
AA Change: D144G

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 3.3e-28 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
Pfam:SDA1 409 532 2.4e-41 PFAM
Pfam:SDA1 519 685 2.8e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201084
Predicted Effect probably damaging
Transcript: ENSMUST00000201143
AA Change: D144G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144446
Gene: ENSMUSG00000029415
AA Change: D144G

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 5.3e-24 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 277 N/A INTRINSIC
Pfam:SDA1 408 531 3.9e-37 PFAM
Pfam:SDA1 518 684 4.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202680
Predicted Effect probably benign
Transcript: ENSMUST00000202870
Meta Mutation Damage Score 0.8491 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,180,514 R228H probably damaging Het
9930021J03Rik C T 19: 29,717,747 V1449I probably benign Het
A2ml1 T C 6: 128,552,236 D981G probably damaging Het
Abcc1 C A 16: 14,465,056 A1132D probably damaging Het
Adamts12 A G 15: 11,241,433 T364A probably damaging Het
Ahnak A T 19: 9,006,625 M1758L probably benign Het
Ak9 T C 10: 41,382,829 V774A probably damaging Het
Ash1l A G 3: 89,007,865 E1934G probably benign Het
Atp2b2 C T 6: 113,797,131 A341T probably benign Het
Bach2 G T 4: 32,238,816 probably benign Het
Ccdc102a T C 8: 94,911,516 T241A probably benign Het
Chd5 G T 4: 152,382,408 R1627S probably benign Het
Clint1 T C 11: 45,895,081 S322P probably benign Het
Dapk1 T A 13: 60,729,442 C498* probably null Het
Diaph3 T G 14: 86,866,540 S803R probably damaging Het
Dmp1 T C 5: 104,207,125 L10P probably damaging Het
Gcc2 T C 10: 58,271,465 V741A probably benign Het
Gldn A G 9: 54,286,878 M119V probably benign Het
Gucy1b1 A G 3: 82,034,411 S574P possibly damaging Het
Hapln4 T A 8: 70,084,423 probably benign Het
Hars A G 18: 36,771,332 V209A probably benign Het
Htt T A 5: 34,895,887 F2521L possibly damaging Het
Kif14 A G 1: 136,515,986 D1299G probably null Het
Krt25 T A 11: 99,317,427 E325V probably damaging Het
Lcmt1 T C 7: 123,378,182 probably benign Het
Lrp1b A T 2: 40,803,209 N3266K probably damaging Het
Marc2 A G 1: 184,819,328 S304P probably damaging Het
Mctp1 T A 13: 77,020,863 probably null Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Myom3 A G 4: 135,776,377 N379S possibly damaging Het
Nbea A T 3: 56,000,616 D1358E possibly damaging Het
Nod1 T C 6: 54,924,983 E939G probably damaging Het
Obox1 A G 7: 15,555,369 R70G probably benign Het
Olfr1024 T C 2: 85,904,216 I279M probably benign Het
Olfr1239 C T 2: 89,418,351 G21S probably benign Het
Olfr1341 A G 4: 118,709,947 E180G probably benign Het
Olfr272 A G 4: 52,911,399 Y132H probably damaging Het
Otof T C 5: 30,371,935 D1745G possibly damaging Het
Pklr A G 3: 89,137,355 I47V probably damaging Het
Pms2 T A 5: 143,914,633 S123T possibly damaging Het
Pnpla2 T C 7: 141,459,285 S337P probably damaging Het
Ptgfrn A C 3: 101,045,620 V766G possibly damaging Het
Ptpn11 T A 5: 121,144,653 H419L probably damaging Het
Rims3 T A 4: 120,883,153 V99E probably damaging Het
Samd9l A G 6: 3,376,361 V300A probably damaging Het
Siglecg T C 7: 43,408,754 Y22H possibly damaging Het
Slc39a1 A G 3: 90,252,281 K305R possibly damaging Het
Slc5a4a A G 10: 76,178,200 R414G probably damaging Het
Smg1 T C 7: 118,154,277 probably benign Het
Tbc1d9b C T 11: 50,131,497 A20V possibly damaging Het
Tgfb3 G T 12: 86,063,864 D237E probably benign Het
Tle6 A G 10: 81,595,239 S234P probably benign Het
Tnrc6b A G 15: 80,879,614 N439S probably benign Het
Trim33 T C 3: 103,341,609 S783P probably benign Het
Ttn A T 2: 76,802,354 Y12373N probably damaging Het
Tube1 G A 10: 39,134,101 V7I probably benign Het
Tufm T C 7: 126,489,238 V265A probably benign Het
Uhrf1bp1 T C 17: 27,893,201 I1150T probably benign Het
Usp32 T C 11: 84,986,576 H1550R possibly damaging Het
Usp33 A T 3: 152,376,250 M546L probably damaging Het
Uspl1 C A 5: 149,214,287 Q752K probably benign Het
Vmn1r20 A G 6: 57,431,670 probably null Het
Vmn1r201 T C 13: 22,475,351 F245S probably damaging Het
Vmn2r3 A G 3: 64,278,761 S168P probably damaging Het
Wdr24 T G 17: 25,825,676 D168E possibly damaging Het
Zfp646 C T 7: 127,883,681 P1677S probably damaging Het
Other mutations in Sdad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Sdad1 APN 5 92303773 splice site probably null
IGL01355:Sdad1 APN 5 92302679 missense probably damaging 1.00
IGL01635:Sdad1 APN 5 92297160 missense probably damaging 0.98
IGL02166:Sdad1 APN 5 92291762 missense probably benign 0.03
IGL02503:Sdad1 APN 5 92301802 unclassified probably benign
IGL02739:Sdad1 APN 5 92290072 missense probably benign 0.43
PIT4468001:Sdad1 UTSW 5 92291918 missense probably damaging 1.00
R0583:Sdad1 UTSW 5 92305064 missense probably damaging 0.97
R1169:Sdad1 UTSW 5 92298233 missense probably benign 0.32
R1496:Sdad1 UTSW 5 92309823 missense possibly damaging 0.94
R1844:Sdad1 UTSW 5 92305296 nonsense probably null
R1848:Sdad1 UTSW 5 92292651 critical splice donor site probably null
R2419:Sdad1 UTSW 5 92305818 missense possibly damaging 0.69
R2497:Sdad1 UTSW 5 92300099 missense probably benign 0.00
R2509:Sdad1 UTSW 5 92305825 missense probably benign 0.12
R4043:Sdad1 UTSW 5 92302694 missense probably damaging 0.96
R4384:Sdad1 UTSW 5 92298257 missense probably benign 0.01
R4477:Sdad1 UTSW 5 92297160 missense probably damaging 0.98
R4478:Sdad1 UTSW 5 92297160 missense probably damaging 0.98
R4734:Sdad1 UTSW 5 92304977 missense possibly damaging 0.61
R4749:Sdad1 UTSW 5 92304977 missense possibly damaging 0.61
R5135:Sdad1 UTSW 5 92303934 missense probably benign 0.00
R5288:Sdad1 UTSW 5 92286825 makesense probably null
R7038:Sdad1 UTSW 5 92298190 critical splice donor site probably null
R7099:Sdad1 UTSW 5 92293973 missense possibly damaging 0.89
R7420:Sdad1 UTSW 5 92305737 missense possibly damaging 0.91
R7425:Sdad1 UTSW 5 92300121 missense probably benign 0.10
R7714:Sdad1 UTSW 5 92302679 missense probably damaging 1.00
R8048:Sdad1 UTSW 5 92300089 missense not run
Predicted Primers PCR Primer
(F):5'- GGTTGCATTGCTGTCTCTCAAC -3'
(R):5'- AGAGAGCAGCAGTCTTACCG -3'

Sequencing Primer
(F):5'- GTGTACATGAAGTTCTGCAGCACC -3'
(R):5'- AGAGCAGCAGTCTTACCGTTTCAG -3'
Posted On2018-04-02