Mutagenetix > Incidental Mutation

Incidental Mutation 'R6331:Samd9l'

510912

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6331 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 3376361 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 300 (V300A)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000120087
AA Change: V300A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: V300A

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Meta Mutation Damage Score

0.5084

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

100% (66/66)

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	G	A	18: 12,180,514	R228H	probably damaging	Het
9930021J03Rik	C	T	19: 29,717,747	V1449I	probably benign	Het
A2ml1	T	C	6: 128,552,236	D981G	probably damaging	Het
Abcc1	C	A	16: 14,465,056	A1132D	probably damaging	Het
Adamts12	A	G	15: 11,241,433	T364A	probably damaging	Het
Ahnak	A	T	19: 9,006,625	M1758L	probably benign	Het
Ak9	T	C	10: 41,382,829	V774A	probably damaging	Het
Ash1l	A	G	3: 89,007,865	E1934G	probably benign	Het
Atp2b2	C	T	6: 113,797,131	A341T	probably benign	Het
Bach2	G	T	4: 32,238,816		probably benign	Het
Ccdc102a	T	C	8: 94,911,516	T241A	probably benign	Het
Chd5	G	T	4: 152,382,408	R1627S	probably benign	Het
Clint1	T	C	11: 45,895,081	S322P	probably benign	Het
Dapk1	T	A	13: 60,729,442	C498*	probably null	Het
Diaph3	T	G	14: 86,866,540	S803R	probably damaging	Het
Dmp1	T	C	5: 104,207,125	L10P	probably damaging	Het
Gcc2	T	C	10: 58,271,465	V741A	probably benign	Het
Gldn	A	G	9: 54,286,878	M119V	probably benign	Het
Gucy1b1	A	G	3: 82,034,411	S574P	possibly damaging	Het
Hapln4	T	A	8: 70,084,423		probably benign	Het
Hars	A	G	18: 36,771,332	V209A	probably benign	Het
Htt	T	A	5: 34,895,887	F2521L	possibly damaging	Het
Kif14	A	G	1: 136,515,986	D1299G	probably null	Het
Krt25	T	A	11: 99,317,427	E325V	probably damaging	Het
Lcmt1	T	C	7: 123,378,182		probably benign	Het
Lrp1b	A	T	2: 40,803,209	N3266K	probably damaging	Het
Marc2	A	G	1: 184,819,328	S304P	probably damaging	Het
Mctp1	T	A	13: 77,020,863		probably null	Het
Myo5b	G	A	18: 74,616,993	A176T	probably damaging	Het
Myom3	A	G	4: 135,776,377	N379S	possibly damaging	Het
Nbea	A	T	3: 56,000,616	D1358E	possibly damaging	Het
Nod1	T	C	6: 54,924,983	E939G	probably damaging	Het
Obox1	A	G	7: 15,555,369	R70G	probably benign	Het
Olfr1024	T	C	2: 85,904,216	I279M	probably benign	Het
Olfr1239	C	T	2: 89,418,351	G21S	probably benign	Het
Olfr1341	A	G	4: 118,709,947	E180G	probably benign	Het
Olfr272	A	G	4: 52,911,399	Y132H	probably damaging	Het
Otof	T	C	5: 30,371,935	D1745G	possibly damaging	Het
Pklr	A	G	3: 89,137,355	I47V	probably damaging	Het
Pms2	T	A	5: 143,914,633	S123T	possibly damaging	Het
Pnpla2	T	C	7: 141,459,285	S337P	probably damaging	Het
Ptgfrn	A	C	3: 101,045,620	V766G	possibly damaging	Het
Ptpn11	T	A	5: 121,144,653	H419L	probably damaging	Het
Rims3	T	A	4: 120,883,153	V99E	probably damaging	Het
Sdad1	T	C	5: 92,303,930	D144G	probably damaging	Het
Siglecg	T	C	7: 43,408,754	Y22H	possibly damaging	Het
Slc39a1	A	G	3: 90,252,281	K305R	possibly damaging	Het
Slc5a4a	A	G	10: 76,178,200	R414G	probably damaging	Het
Smg1	T	C	7: 118,154,277		probably benign	Het
Tbc1d9b	C	T	11: 50,131,497	A20V	possibly damaging	Het
Tgfb3	G	T	12: 86,063,864	D237E	probably benign	Het
Tle6	A	G	10: 81,595,239	S234P	probably benign	Het
Tnrc6b	A	G	15: 80,879,614	N439S	probably benign	Het
Trim33	T	C	3: 103,341,609	S783P	probably benign	Het
Ttn	A	T	2: 76,802,354	Y12373N	probably damaging	Het
Tube1	G	A	10: 39,134,101	V7I	probably benign	Het
Tufm	T	C	7: 126,489,238	V265A	probably benign	Het
Uhrf1bp1	T	C	17: 27,893,201	I1150T	probably benign	Het
Usp32	T	C	11: 84,986,576	H1550R	possibly damaging	Het
Usp33	A	T	3: 152,376,250	M546L	probably damaging	Het
Uspl1	C	A	5: 149,214,287	Q752K	probably benign	Het
Vmn1r20	A	G	6: 57,431,670		probably null	Het
Vmn1r201	T	C	13: 22,475,351	F245S	probably damaging	Het
Vmn2r3	A	G	3: 64,278,761	S168P	probably damaging	Het
Wdr24	T	G	17: 25,825,676	D168E	possibly damaging	Het
Zfp646	C	T	7: 127,883,681	P1677S	probably damaging	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
Paine	UTSW	6	3372716	missense	probably damaging	0.99
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3373126	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3374032	nonsense	probably null
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3376156	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3373291	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3376460	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3375383	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3375856	nonsense	probably null
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7667:Samd9l	UTSW	6	3375975	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3374749	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3373843	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3374221	nonsense	probably null
R8806:Samd9l	UTSW	6	3376665	missense	probably damaging	0.99
R8832:Samd9l	UTSW	6	3374990	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3374577	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3373791	missense	probably damaging	1.00
R9051:Samd9l	UTSW	6	3373493	missense	probably benign	0.16
R9108:Samd9l	UTSW	6	3373104	missense	possibly damaging	0.71
R9213:Samd9l	UTSW	6	3376856	missense	probably benign	0.23
R9494:Samd9l	UTSW	6	3375830	missense	possibly damaging	0.51
R9504:Samd9l	UTSW	6	3372621	missense	probably benign	0.17
R9655:Samd9l	UTSW	6	3373578	missense	probably benign	0.00
R9688:Samd9l	UTSW	6	3377087	missense	probably damaging	1.00
R9696:Samd9l	UTSW	6	3375078	missense	possibly damaging	0.76
R9721:Samd9l	UTSW	6	3375854	missense	possibly damaging	0.69
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCGGCCGCTTTTCTAGACG -3'
(R):5'- AATTGTTGGTGTGCAAGTCAC -3'

Sequencing Primer
(F):5'- AGACGCTGTCCACATCTTTAAATC -3'
(R):5'- GTGTGCAAGTCACCAGTAAAGATATC -3'

Posted On

2018-04-02