Incidental Mutation 'R6331:Slc5a4a'
ID510928
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Namesolute carrier family 5, member 4a
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6331 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location76147451-76189265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76178200 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 414 (R414G)
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
Predicted Effect probably damaging
Transcript: ENSMUST00000020450
AA Change: R414G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229
AA Change: R414G

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,180,514 R228H probably damaging Het
9930021J03Rik C T 19: 29,717,747 V1449I probably benign Het
A2ml1 T C 6: 128,552,236 D981G probably damaging Het
Abcc1 C A 16: 14,465,056 A1132D probably damaging Het
Adamts12 A G 15: 11,241,433 T364A probably damaging Het
Ahnak A T 19: 9,006,625 M1758L probably benign Het
Ak9 T C 10: 41,382,829 V774A probably damaging Het
Ash1l A G 3: 89,007,865 E1934G probably benign Het
Atp2b2 C T 6: 113,797,131 A341T probably benign Het
Bach2 G T 4: 32,238,816 probably benign Het
Ccdc102a T C 8: 94,911,516 T241A probably benign Het
Chd5 G T 4: 152,382,408 R1627S probably benign Het
Clint1 T C 11: 45,895,081 S322P probably benign Het
Dapk1 T A 13: 60,729,442 C498* probably null Het
Diaph3 T G 14: 86,866,540 S803R probably damaging Het
Dmp1 T C 5: 104,207,125 L10P probably damaging Het
Gcc2 T C 10: 58,271,465 V741A probably benign Het
Gldn A G 9: 54,286,878 M119V probably benign Het
Gucy1b1 A G 3: 82,034,411 S574P possibly damaging Het
Hapln4 T A 8: 70,084,423 probably benign Het
Hars A G 18: 36,771,332 V209A probably benign Het
Htt T A 5: 34,895,887 F2521L possibly damaging Het
Kif14 A G 1: 136,515,986 D1299G probably null Het
Krt25 T A 11: 99,317,427 E325V probably damaging Het
Lcmt1 T C 7: 123,378,182 probably benign Het
Lrp1b A T 2: 40,803,209 N3266K probably damaging Het
Marc2 A G 1: 184,819,328 S304P probably damaging Het
Mctp1 T A 13: 77,020,863 probably null Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Myom3 A G 4: 135,776,377 N379S possibly damaging Het
Nbea A T 3: 56,000,616 D1358E possibly damaging Het
Nod1 T C 6: 54,924,983 E939G probably damaging Het
Obox1 A G 7: 15,555,369 R70G probably benign Het
Olfr1024 T C 2: 85,904,216 I279M probably benign Het
Olfr1239 C T 2: 89,418,351 G21S probably benign Het
Olfr1341 A G 4: 118,709,947 E180G probably benign Het
Olfr272 A G 4: 52,911,399 Y132H probably damaging Het
Otof T C 5: 30,371,935 D1745G possibly damaging Het
Pklr A G 3: 89,137,355 I47V probably damaging Het
Pms2 T A 5: 143,914,633 S123T possibly damaging Het
Pnpla2 T C 7: 141,459,285 S337P probably damaging Het
Ptgfrn A C 3: 101,045,620 V766G possibly damaging Het
Ptpn11 T A 5: 121,144,653 H419L probably damaging Het
Rims3 T A 4: 120,883,153 V99E probably damaging Het
Samd9l A G 6: 3,376,361 V300A probably damaging Het
Sdad1 T C 5: 92,303,930 D144G probably damaging Het
Siglecg T C 7: 43,408,754 Y22H possibly damaging Het
Slc39a1 A G 3: 90,252,281 K305R possibly damaging Het
Smg1 T C 7: 118,154,277 probably benign Het
Tbc1d9b C T 11: 50,131,497 A20V possibly damaging Het
Tgfb3 G T 12: 86,063,864 D237E probably benign Het
Tle6 A G 10: 81,595,239 S234P probably benign Het
Tnrc6b A G 15: 80,879,614 N439S probably benign Het
Trim33 T C 3: 103,341,609 S783P probably benign Het
Ttn A T 2: 76,802,354 Y12373N probably damaging Het
Tube1 G A 10: 39,134,101 V7I probably benign Het
Tufm T C 7: 126,489,238 V265A probably benign Het
Uhrf1bp1 T C 17: 27,893,201 I1150T probably benign Het
Usp32 T C 11: 84,986,576 H1550R possibly damaging Het
Usp33 A T 3: 152,376,250 M546L probably damaging Het
Uspl1 C A 5: 149,214,287 Q752K probably benign Het
Vmn1r20 A G 6: 57,431,670 probably null Het
Vmn1r201 T C 13: 22,475,351 F245S probably damaging Het
Vmn2r3 A G 3: 64,278,761 S168P probably damaging Het
Wdr24 T G 17: 25,825,676 D168E possibly damaging Het
Zfp646 C T 7: 127,883,681 P1677S probably damaging Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 76163733 missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76181674 missense probably benign 0.00
IGL02629:Slc5a4a APN 10 76147579 missense unknown
IGL02976:Slc5a4a APN 10 76170693 missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 76150512 missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 76150552 missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76178197 missense probably null 0.00
R0244:Slc5a4a UTSW 10 76189152 missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76182722 missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76176534 missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76178161 missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76186528 missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76189269 unclassified probably null
R1857:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1942:Slc5a4a UTSW 10 76147588 missense unknown
R2016:Slc5a4a UTSW 10 76153580 missense probably benign 0.00
R2316:Slc5a4a UTSW 10 76178081 splice site probably null
R3420:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76189149 missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76181655 missense probably benign 0.42
R4523:Slc5a4a UTSW 10 76148362 missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76178095 nonsense probably null
R4538:Slc5a4a UTSW 10 76178095 nonsense probably null
R4755:Slc5a4a UTSW 10 76186564 missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76178231 missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 76147594 missense unknown
R5254:Slc5a4a UTSW 10 76182738 nonsense probably null
R6083:Slc5a4a UTSW 10 76147597 missense unknown
R7591:Slc5a4a UTSW 10 76147667 critical splice donor site probably benign
R7671:Slc5a4a UTSW 10 76147550 missense unknown
Z1177:Slc5a4a UTSW 10 76166744 missense probably benign 0.01
Z1177:Slc5a4a UTSW 10 76182847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCAGTGACTGTTCCTGAG -3'
(R):5'- GAGATGCGTTAAACCATTCCCAG -3'

Sequencing Primer
(F):5'- TGTTCCTGAGAAATCCAGCG -3'
(R):5'- GCGTTAAACCATTCCCAGTGTCAC -3'
Posted On2018-04-02