Incidental Mutation 'R6331:Krt25'
ID510932
Institutional Source Beutler Lab
Gene Symbol Krt25
Ensembl Gene ENSMUSG00000035831
Gene Namekeratin 25
Synonyms4631426H08Rik, mIRSa1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6331 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location99315516-99322951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99317427 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 325 (E325V)
Ref Sequence ENSEMBL: ENSMUSP00000048439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038004]
Predicted Effect probably damaging
Transcript: ENSMUST00000038004
AA Change: E325V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048439
Gene: ENSMUSG00000035831
AA Change: E325V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
Filament 74 389 4.13e-146 SMART
low complexity region 391 403 N/A INTRINSIC
Meta Mutation Damage Score 0.5823 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutations in this gene have a defect in hair formation resulting in a wavy coat and curly vibrissae. Some alleles may compromise normal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,180,514 R228H probably damaging Het
9930021J03Rik C T 19: 29,717,747 V1449I probably benign Het
A2ml1 T C 6: 128,552,236 D981G probably damaging Het
Abcc1 C A 16: 14,465,056 A1132D probably damaging Het
Adamts12 A G 15: 11,241,433 T364A probably damaging Het
Ahnak A T 19: 9,006,625 M1758L probably benign Het
Ak9 T C 10: 41,382,829 V774A probably damaging Het
Ash1l A G 3: 89,007,865 E1934G probably benign Het
Atp2b2 C T 6: 113,797,131 A341T probably benign Het
Bach2 G T 4: 32,238,816 probably benign Het
Ccdc102a T C 8: 94,911,516 T241A probably benign Het
Chd5 G T 4: 152,382,408 R1627S probably benign Het
Clint1 T C 11: 45,895,081 S322P probably benign Het
Dapk1 T A 13: 60,729,442 C498* probably null Het
Diaph3 T G 14: 86,866,540 S803R probably damaging Het
Dmp1 T C 5: 104,207,125 L10P probably damaging Het
Gcc2 T C 10: 58,271,465 V741A probably benign Het
Gldn A G 9: 54,286,878 M119V probably benign Het
Gucy1b1 A G 3: 82,034,411 S574P possibly damaging Het
Hapln4 T A 8: 70,084,423 probably benign Het
Hars A G 18: 36,771,332 V209A probably benign Het
Htt T A 5: 34,895,887 F2521L possibly damaging Het
Kif14 A G 1: 136,515,986 D1299G probably null Het
Lcmt1 T C 7: 123,378,182 probably benign Het
Lrp1b A T 2: 40,803,209 N3266K probably damaging Het
Marc2 A G 1: 184,819,328 S304P probably damaging Het
Mctp1 T A 13: 77,020,863 probably null Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Myom3 A G 4: 135,776,377 N379S possibly damaging Het
Nbea A T 3: 56,000,616 D1358E possibly damaging Het
Nod1 T C 6: 54,924,983 E939G probably damaging Het
Obox1 A G 7: 15,555,369 R70G probably benign Het
Olfr1024 T C 2: 85,904,216 I279M probably benign Het
Olfr1239 C T 2: 89,418,351 G21S probably benign Het
Olfr1341 A G 4: 118,709,947 E180G probably benign Het
Olfr272 A G 4: 52,911,399 Y132H probably damaging Het
Otof T C 5: 30,371,935 D1745G possibly damaging Het
Pklr A G 3: 89,137,355 I47V probably damaging Het
Pms2 T A 5: 143,914,633 S123T possibly damaging Het
Pnpla2 T C 7: 141,459,285 S337P probably damaging Het
Ptgfrn A C 3: 101,045,620 V766G possibly damaging Het
Ptpn11 T A 5: 121,144,653 H419L probably damaging Het
Rims3 T A 4: 120,883,153 V99E probably damaging Het
Samd9l A G 6: 3,376,361 V300A probably damaging Het
Sdad1 T C 5: 92,303,930 D144G probably damaging Het
Siglecg T C 7: 43,408,754 Y22H possibly damaging Het
Slc39a1 A G 3: 90,252,281 K305R possibly damaging Het
Slc5a4a A G 10: 76,178,200 R414G probably damaging Het
Smg1 T C 7: 118,154,277 probably benign Het
Tbc1d9b C T 11: 50,131,497 A20V possibly damaging Het
Tgfb3 G T 12: 86,063,864 D237E probably benign Het
Tle6 A G 10: 81,595,239 S234P probably benign Het
Tnrc6b A G 15: 80,879,614 N439S probably benign Het
Trim33 T C 3: 103,341,609 S783P probably benign Het
Ttn A T 2: 76,802,354 Y12373N probably damaging Het
Tube1 G A 10: 39,134,101 V7I probably benign Het
Tufm T C 7: 126,489,238 V265A probably benign Het
Uhrf1bp1 T C 17: 27,893,201 I1150T probably benign Het
Usp32 T C 11: 84,986,576 H1550R possibly damaging Het
Usp33 A T 3: 152,376,250 M546L probably damaging Het
Uspl1 C A 5: 149,214,287 Q752K probably benign Het
Vmn1r20 A G 6: 57,431,670 probably null Het
Vmn1r201 T C 13: 22,475,351 F245S probably damaging Het
Vmn2r3 A G 3: 64,278,761 S168P probably damaging Het
Wdr24 T G 17: 25,825,676 D168E possibly damaging Het
Zfp646 C T 7: 127,883,681 P1677S probably damaging Het
Other mutations in Krt25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Krt25 APN 11 99318170 missense probably benign 0.28
IGL02415:Krt25 APN 11 99322572 missense probably damaging 1.00
IGL02816:Krt25 APN 11 99318151 missense probably benign 0.10
Plush UTSW 11 99322635 missense probably damaging 1.00
Sinuous UTSW 11 99322630 missense probably damaging 0.99
R0138:Krt25 UTSW 11 99322698 missense probably benign 0.00
R0219:Krt25 UTSW 11 99318059 missense probably benign 0.01
R0932:Krt25 UTSW 11 99321283 missense possibly damaging 0.94
R1733:Krt25 UTSW 11 99316552 nonsense probably null
R1855:Krt25 UTSW 11 99318315 missense probably damaging 1.00
R2120:Krt25 UTSW 11 99321197 missense probably benign 0.01
R2504:Krt25 UTSW 11 99317296 nonsense probably null
R3615:Krt25 UTSW 11 99317298 missense possibly damaging 0.64
R3616:Krt25 UTSW 11 99317298 missense possibly damaging 0.64
R4590:Krt25 UTSW 11 99318028 intron probably benign
R6250:Krt25 UTSW 11 99321163 missense probably damaging 1.00
R6927:Krt25 UTSW 11 99317379 missense probably damaging 1.00
R7067:Krt25 UTSW 11 99317383 missense probably benign 0.01
R7289:Krt25 UTSW 11 99321272 missense probably benign 0.15
R7360:Krt25 UTSW 11 99317406 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCAGTAGGTCTCGATCTC -3'
(R):5'- ATCACTGAGGACATGGTGTTTG -3'

Sequencing Primer
(F):5'- GATCTCCTTCTCCAGGTGGG -3'
(R):5'- CCTGGAACTCAGTGATGTAGACC -3'
Posted On2018-04-02