Incidental Mutation 'R6331:3110002H16Rik'
ID510943
Institutional Source Beutler Lab
Gene Symbol 3110002H16Rik
Ensembl Gene ENSMUSG00000024410
Gene NameRIKEN cDNA 3110002H16 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R6331 (G1)
Quality Score220.009
Status Validated
Chromosome18
Chromosomal Location12168717-12189997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12180514 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 228 (R228H)
Ref Sequence ENSEMBL: ENSMUSP00000025276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025276] [ENSMUST00000134046] [ENSMUST00000138866]
Predicted Effect probably damaging
Transcript: ENSMUST00000025276
AA Change: R228H

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025276
Gene: ENSMUSG00000024410
AA Change: R228H

DomainStartEndE-ValueType
SCOP:d1crza1 21 169 5e-4 SMART
low complexity region 268 281 N/A INTRINSIC
Pfam:Mic1 475 632 4.4e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127123
Predicted Effect possibly damaging
Transcript: ENSMUST00000134046
AA Change: R18H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118783
Gene: ENSMUSG00000024410
AA Change: R18H

DomainStartEndE-ValueType
low complexity region 58 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138866
SMART Domains Protein: ENSMUSP00000121414
Gene: ENSMUSG00000024410

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155431
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer associated protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik C T 19: 29,717,747 V1449I probably benign Het
A2ml1 T C 6: 128,552,236 D981G probably damaging Het
Abcc1 C A 16: 14,465,056 A1132D probably damaging Het
Adamts12 A G 15: 11,241,433 T364A probably damaging Het
Ahnak A T 19: 9,006,625 M1758L probably benign Het
Ak9 T C 10: 41,382,829 V774A probably damaging Het
Ash1l A G 3: 89,007,865 E1934G probably benign Het
Atp2b2 C T 6: 113,797,131 A341T probably benign Het
Bach2 G T 4: 32,238,816 probably benign Het
Ccdc102a T C 8: 94,911,516 T241A probably benign Het
Chd5 G T 4: 152,382,408 R1627S probably benign Het
Clint1 T C 11: 45,895,081 S322P probably benign Het
Dapk1 T A 13: 60,729,442 C498* probably null Het
Diaph3 T G 14: 86,866,540 S803R probably damaging Het
Dmp1 T C 5: 104,207,125 L10P probably damaging Het
Gcc2 T C 10: 58,271,465 V741A probably benign Het
Gldn A G 9: 54,286,878 M119V probably benign Het
Gucy1b1 A G 3: 82,034,411 S574P possibly damaging Het
Hapln4 T A 8: 70,084,423 probably benign Het
Hars A G 18: 36,771,332 V209A probably benign Het
Htt T A 5: 34,895,887 F2521L possibly damaging Het
Kif14 A G 1: 136,515,986 D1299G probably null Het
Krt25 T A 11: 99,317,427 E325V probably damaging Het
Lcmt1 T C 7: 123,378,182 probably benign Het
Lrp1b A T 2: 40,803,209 N3266K probably damaging Het
Marc2 A G 1: 184,819,328 S304P probably damaging Het
Mctp1 T A 13: 77,020,863 probably null Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Myom3 A G 4: 135,776,377 N379S possibly damaging Het
Nbea A T 3: 56,000,616 D1358E possibly damaging Het
Nod1 T C 6: 54,924,983 E939G probably damaging Het
Obox1 A G 7: 15,555,369 R70G probably benign Het
Olfr1024 T C 2: 85,904,216 I279M probably benign Het
Olfr1239 C T 2: 89,418,351 G21S probably benign Het
Olfr1341 A G 4: 118,709,947 E180G probably benign Het
Olfr272 A G 4: 52,911,399 Y132H probably damaging Het
Otof T C 5: 30,371,935 D1745G possibly damaging Het
Pklr A G 3: 89,137,355 I47V probably damaging Het
Pms2 T A 5: 143,914,633 S123T possibly damaging Het
Pnpla2 T C 7: 141,459,285 S337P probably damaging Het
Ptgfrn A C 3: 101,045,620 V766G possibly damaging Het
Ptpn11 T A 5: 121,144,653 H419L probably damaging Het
Rims3 T A 4: 120,883,153 V99E probably damaging Het
Samd9l A G 6: 3,376,361 V300A probably damaging Het
Sdad1 T C 5: 92,303,930 D144G probably damaging Het
Siglecg T C 7: 43,408,754 Y22H possibly damaging Het
Slc39a1 A G 3: 90,252,281 K305R possibly damaging Het
Slc5a4a A G 10: 76,178,200 R414G probably damaging Het
Smg1 T C 7: 118,154,277 probably benign Het
Tbc1d9b C T 11: 50,131,497 A20V possibly damaging Het
Tgfb3 G T 12: 86,063,864 D237E probably benign Het
Tle6 A G 10: 81,595,239 S234P probably benign Het
Tnrc6b A G 15: 80,879,614 N439S probably benign Het
Trim33 T C 3: 103,341,609 S783P probably benign Het
Ttn A T 2: 76,802,354 Y12373N probably damaging Het
Tube1 G A 10: 39,134,101 V7I probably benign Het
Tufm T C 7: 126,489,238 V265A probably benign Het
Uhrf1bp1 T C 17: 27,893,201 I1150T probably benign Het
Usp32 T C 11: 84,986,576 H1550R possibly damaging Het
Usp33 A T 3: 152,376,250 M546L probably damaging Het
Uspl1 C A 5: 149,214,287 Q752K probably benign Het
Vmn1r20 A G 6: 57,431,670 probably null Het
Vmn1r201 T C 13: 22,475,351 F245S probably damaging Het
Vmn2r3 A G 3: 64,278,761 S168P probably damaging Het
Wdr24 T G 17: 25,825,676 D168E possibly damaging Het
Zfp646 C T 7: 127,883,681 P1677S probably damaging Het
Other mutations in 3110002H16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:3110002H16Rik APN 18 12179219 missense probably benign 0.00
IGL01883:3110002H16Rik APN 18 12178239 missense probably benign 0.03
IGL01956:3110002H16Rik APN 18 12189350 missense probably damaging 0.99
IGL02828:3110002H16Rik APN 18 12189221 missense possibly damaging 0.52
IGL03147:3110002H16Rik APN 18 12169229 splice site probably benign
R0147:3110002H16Rik UTSW 18 12189271 missense probably damaging 0.99
R0357:3110002H16Rik UTSW 18 12179209 missense possibly damaging 0.87
R1108:3110002H16Rik UTSW 18 12181623 missense probably damaging 0.99
R1422:3110002H16Rik UTSW 18 12181623 missense probably damaging 0.99
R1939:3110002H16Rik UTSW 18 12180505 missense probably damaging 1.00
R4300:3110002H16Rik UTSW 18 12188862 missense probably benign 0.00
R4826:3110002H16Rik UTSW 18 12185779 intron probably benign
R5103:3110002H16Rik UTSW 18 12189262 missense probably benign
R5345:3110002H16Rik UTSW 18 12179177 missense probably benign
R5506:3110002H16Rik UTSW 18 12188956 unclassified probably benign
R5566:3110002H16Rik UTSW 18 12180692 missense possibly damaging 0.90
R5574:3110002H16Rik UTSW 18 12185006 frame shift probably null
R5632:3110002H16Rik UTSW 18 12171583 missense possibly damaging 0.63
R6765:3110002H16Rik UTSW 18 12176146 missense possibly damaging 0.82
R6978:3110002H16Rik UTSW 18 12185747 missense probably benign
R7310:3110002H16Rik UTSW 18 12184915 missense probably benign 0.13
R7734:3110002H16Rik UTSW 18 12189263 missense possibly damaging 0.81
X0062:3110002H16Rik UTSW 18 12179519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGAGAACTCAGACTGTCCC -3'
(R):5'- TTTAGGGCAAACTTTCCCGTCC -3'

Sequencing Primer
(F):5'- GAGAACTCAGACTGTCCCTTTAAGG -3'
(R):5'- GGGCAAACTTTCCCGTCCTATTTAAC -3'
Posted On2018-04-02