Incidental Mutation 'R6331:Myo5b'
ID 510945
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Name myosin VB
Synonyms
MMRRC Submission 044485-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.769) question?
Stock # R6331 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 74575435-74905769 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74750064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 176 (A176T)
Ref Sequence ENSEMBL: ENSMUSP00000073790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875] [ENSMUST00000125882]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074157
AA Change: A176T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: A176T

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120161
Predicted Effect probably damaging
Transcript: ENSMUST00000121875
AA Change: A176T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: A176T

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125882
AA Change: A174T

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123123
Gene: ENSMUSG00000025885
AA Change: A174T

DomainStartEndE-ValueType
MYSc 61 183 8.63e-4 SMART
Meta Mutation Damage Score 0.1112 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,529,199 (GRCm39) D981G probably damaging Het
Abcc1 C A 16: 14,282,920 (GRCm39) A1132D probably damaging Het
Adamts12 A G 15: 11,241,519 (GRCm39) T364A probably damaging Het
Ahnak A T 19: 8,983,989 (GRCm39) M1758L probably benign Het
Ak9 T C 10: 41,258,825 (GRCm39) V774A probably damaging Het
Ash1l A G 3: 88,915,172 (GRCm39) E1934G probably benign Het
Atp2b2 C T 6: 113,774,092 (GRCm39) A341T probably benign Het
Bach2 G T 4: 32,238,816 (GRCm39) probably benign Het
Bltp3a T C 17: 28,112,175 (GRCm39) I1150T probably benign Het
Brd10 C T 19: 29,695,147 (GRCm39) V1449I probably benign Het
Ccdc102a T C 8: 95,638,144 (GRCm39) T241A probably benign Het
Chd5 G T 4: 152,466,865 (GRCm39) R1627S probably benign Het
Clint1 T C 11: 45,785,908 (GRCm39) S322P probably benign Het
Dapk1 T A 13: 60,877,256 (GRCm39) C498* probably null Het
Diaph3 T G 14: 87,103,976 (GRCm39) S803R probably damaging Het
Dmp1 T C 5: 104,354,991 (GRCm39) L10P probably damaging Het
Gcc2 T C 10: 58,107,287 (GRCm39) V741A probably benign Het
Gldn A G 9: 54,194,162 (GRCm39) M119V probably benign Het
Gucy1b1 A G 3: 81,941,718 (GRCm39) S574P possibly damaging Het
Hapln4 T A 8: 70,537,073 (GRCm39) probably benign Het
Hars1 A G 18: 36,904,385 (GRCm39) V209A probably benign Het
Htt T A 5: 35,053,231 (GRCm39) F2521L possibly damaging Het
Kif14 A G 1: 136,443,724 (GRCm39) D1299G probably null Het
Krt25 T A 11: 99,208,253 (GRCm39) E325V probably damaging Het
Lcmt1 T C 7: 122,977,405 (GRCm39) probably benign Het
Lrp1b A T 2: 40,693,221 (GRCm39) N3266K probably damaging Het
Mctp1 T A 13: 77,168,982 (GRCm39) probably null Het
Mtarc2 A G 1: 184,551,525 (GRCm39) S304P probably damaging Het
Myom3 A G 4: 135,503,688 (GRCm39) N379S possibly damaging Het
Nbea A T 3: 55,908,037 (GRCm39) D1358E possibly damaging Het
Nod1 T C 6: 54,901,968 (GRCm39) E939G probably damaging Het
Obox1 A G 7: 15,289,294 (GRCm39) R70G probably benign Het
Or13c25 A G 4: 52,911,399 (GRCm39) Y132H probably damaging Het
Or13p3 A G 4: 118,567,144 (GRCm39) E180G probably benign Het
Or4a2 C T 2: 89,248,695 (GRCm39) G21S probably benign Het
Or5m12 T C 2: 85,734,560 (GRCm39) I279M probably benign Het
Otof T C 5: 30,529,279 (GRCm39) D1745G possibly damaging Het
Pklr A G 3: 89,044,662 (GRCm39) I47V probably damaging Het
Pms2 T A 5: 143,851,451 (GRCm39) S123T possibly damaging Het
Pnpla2 T C 7: 141,039,198 (GRCm39) S337P probably damaging Het
Ptgfrn A C 3: 100,952,936 (GRCm39) V766G possibly damaging Het
Ptpn11 T A 5: 121,282,716 (GRCm39) H419L probably damaging Het
Rims3 T A 4: 120,740,350 (GRCm39) V99E probably damaging Het
Rmc1 G A 18: 12,313,571 (GRCm39) R228H probably damaging Het
Samd9l A G 6: 3,376,361 (GRCm39) V300A probably damaging Het
Sdad1 T C 5: 92,451,789 (GRCm39) D144G probably damaging Het
Siglecg T C 7: 43,058,178 (GRCm39) Y22H possibly damaging Het
Slc39a1 A G 3: 90,159,588 (GRCm39) K305R possibly damaging Het
Slc5a4a A G 10: 76,014,034 (GRCm39) R414G probably damaging Het
Smg1 T C 7: 117,753,500 (GRCm39) probably benign Het
Tbc1d9b C T 11: 50,022,324 (GRCm39) A20V possibly damaging Het
Tgfb3 G T 12: 86,110,638 (GRCm39) D237E probably benign Het
Tle6 A G 10: 81,431,073 (GRCm39) S234P probably benign Het
Tnrc6b A G 15: 80,763,815 (GRCm39) N439S probably benign Het
Trim33 T C 3: 103,248,925 (GRCm39) S783P probably benign Het
Ttn A T 2: 76,632,698 (GRCm39) Y12373N probably damaging Het
Tube1 G A 10: 39,010,097 (GRCm39) V7I probably benign Het
Tufm T C 7: 126,088,410 (GRCm39) V265A probably benign Het
Usp32 T C 11: 84,877,402 (GRCm39) H1550R possibly damaging Het
Usp33 A T 3: 152,081,887 (GRCm39) M546L probably damaging Het
Uspl1 C A 5: 149,151,097 (GRCm39) Q752K probably benign Het
Vmn1r20 A G 6: 57,408,655 (GRCm39) probably null Het
Vmn1r201 T C 13: 22,659,521 (GRCm39) F245S probably damaging Het
Vmn2r3 A G 3: 64,186,182 (GRCm39) S168P probably damaging Het
Wdr24 T G 17: 26,044,650 (GRCm39) D168E possibly damaging Het
Zfp646 C T 7: 127,482,853 (GRCm39) P1677S probably damaging Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74,787,147 (GRCm39) splice site probably benign
IGL01083:Myo5b APN 18 74,866,974 (GRCm39) splice site probably benign
IGL01448:Myo5b APN 18 74,777,161 (GRCm39) missense probably damaging 0.97
IGL01516:Myo5b APN 18 74,760,266 (GRCm39) missense probably damaging 0.99
IGL01525:Myo5b APN 18 74,873,620 (GRCm39) missense probably damaging 1.00
IGL01873:Myo5b APN 18 74,713,467 (GRCm39) missense probably damaging 1.00
IGL01887:Myo5b APN 18 74,848,007 (GRCm39) missense probably benign 0.41
IGL01953:Myo5b APN 18 74,702,838 (GRCm39) missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74,831,348 (GRCm39) missense probably damaging 1.00
IGL02017:Myo5b APN 18 74,850,070 (GRCm39) missense probably damaging 1.00
IGL02331:Myo5b APN 18 74,771,111 (GRCm39) critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74,848,010 (GRCm39) missense probably damaging 0.98
IGL02707:Myo5b APN 18 74,828,438 (GRCm39) splice site probably benign
IGL02806:Myo5b APN 18 74,750,151 (GRCm39) critical splice donor site probably null
IGL03009:Myo5b APN 18 74,894,039 (GRCm39) missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74,713,615 (GRCm39) splice site probably benign
IGL03061:Myo5b APN 18 74,767,630 (GRCm39) missense probably benign 0.02
unrat UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
BB017:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R0085:Myo5b UTSW 18 74,834,751 (GRCm39) missense probably benign 0.21
R0114:Myo5b UTSW 18 74,875,242 (GRCm39) missense probably benign 0.03
R0226:Myo5b UTSW 18 74,875,251 (GRCm39) missense probably benign
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74,862,025 (GRCm39) splice site probably benign
R0494:Myo5b UTSW 18 74,787,038 (GRCm39) missense probably damaging 1.00
R0920:Myo5b UTSW 18 74,758,712 (GRCm39) missense probably benign 0.09
R1144:Myo5b UTSW 18 74,758,658 (GRCm39) missense probably damaging 1.00
R1177:Myo5b UTSW 18 74,777,143 (GRCm39) missense probably damaging 1.00
R1387:Myo5b UTSW 18 74,777,272 (GRCm39) splice site probably benign
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1555:Myo5b UTSW 18 74,702,853 (GRCm39) missense probably damaging 1.00
R1587:Myo5b UTSW 18 74,867,061 (GRCm39) missense probably benign
R1600:Myo5b UTSW 18 74,846,611 (GRCm39) unclassified probably benign
R1639:Myo5b UTSW 18 74,840,987 (GRCm39) missense probably benign 0.19
R1779:Myo5b UTSW 18 74,875,218 (GRCm39) missense probably benign 0.06
R1806:Myo5b UTSW 18 74,710,680 (GRCm39) missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2046:Myo5b UTSW 18 74,710,526 (GRCm39) missense probably benign 0.28
R2093:Myo5b UTSW 18 74,892,263 (GRCm39) missense probably damaging 0.98
R2270:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2272:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2298:Myo5b UTSW 18 74,758,676 (GRCm39) missense probably damaging 1.00
R2433:Myo5b UTSW 18 74,892,158 (GRCm39) missense probably damaging 1.00
R2888:Myo5b UTSW 18 74,895,689 (GRCm39) missense probably damaging 1.00
R3824:Myo5b UTSW 18 74,794,726 (GRCm39) missense probably benign 0.41
R3937:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3938:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3947:Myo5b UTSW 18 74,828,474 (GRCm39) missense probably damaging 1.00
R3971:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3972:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3974:Myo5b UTSW 18 74,767,552 (GRCm39) missense probably damaging 1.00
R4027:Myo5b UTSW 18 74,892,311 (GRCm39) missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74,873,559 (GRCm39) missense probably benign
R4285:Myo5b UTSW 18 74,847,920 (GRCm39) missense probably benign
R4308:Myo5b UTSW 18 74,864,811 (GRCm39) missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74,831,345 (GRCm39) missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74,713,479 (GRCm39) missense probably damaging 1.00
R4516:Myo5b UTSW 18 74,758,745 (GRCm39) missense probably damaging 1.00
R4690:Myo5b UTSW 18 74,855,533 (GRCm39) missense probably damaging 0.97
R4781:Myo5b UTSW 18 74,877,752 (GRCm39) missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74,828,451 (GRCm39) missense probably benign 0.01
R4796:Myo5b UTSW 18 74,877,701 (GRCm39) missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74,828,455 (GRCm39) missense probably benign 0.19
R4972:Myo5b UTSW 18 74,760,264 (GRCm39) missense probably damaging 0.98
R5004:Myo5b UTSW 18 74,877,844 (GRCm39) critical splice donor site probably null
R5024:Myo5b UTSW 18 74,849,105 (GRCm39) missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74,771,224 (GRCm39) critical splice donor site probably null
R5187:Myo5b UTSW 18 74,834,745 (GRCm39) missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74,848,003 (GRCm39) missense probably damaging 0.99
R5254:Myo5b UTSW 18 74,833,677 (GRCm39) missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74,795,741 (GRCm39) missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74,875,246 (GRCm39) missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74,787,128 (GRCm39) missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74,834,592 (GRCm39) missense probably benign
R5875:Myo5b UTSW 18 74,840,973 (GRCm39) splice site probably null
R6088:Myo5b UTSW 18 74,853,969 (GRCm39) missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74,833,750 (GRCm39) missense probably benign 0.19
R6237:Myo5b UTSW 18 74,875,249 (GRCm39) missense probably damaging 1.00
R6265:Myo5b UTSW 18 74,710,511 (GRCm39) splice site probably null
R6267:Myo5b UTSW 18 74,750,062 (GRCm39) missense probably damaging 1.00
R6328:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6330:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6347:Myo5b UTSW 18 74,903,456 (GRCm39) missense probably benign 0.11
R6479:Myo5b UTSW 18 74,750,086 (GRCm39) missense probably damaging 1.00
R6748:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74,750,106 (GRCm39) missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74,903,396 (GRCm39) missense probably benign
R6876:Myo5b UTSW 18 74,841,026 (GRCm39) missense probably benign
R6880:Myo5b UTSW 18 74,855,501 (GRCm39) missense probably benign 0.02
R6902:Myo5b UTSW 18 74,809,756 (GRCm39) missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74,834,599 (GRCm39) missense probably benign 0.01
R7162:Myo5b UTSW 18 74,828,498 (GRCm39) missense probably benign 0.02
R7345:Myo5b UTSW 18 74,841,095 (GRCm39) missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74,864,802 (GRCm39) missense probably benign 0.00
R7564:Myo5b UTSW 18 74,767,582 (GRCm39) missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74,760,325 (GRCm39) critical splice donor site probably null
R7635:Myo5b UTSW 18 74,713,467 (GRCm39) missense probably damaging 1.00
R7670:Myo5b UTSW 18 74,834,517 (GRCm39) missense probably benign 0.05
R7754:Myo5b UTSW 18 74,767,630 (GRCm39) missense probably benign 0.02
R7930:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R8013:Myo5b UTSW 18 74,893,970 (GRCm39) nonsense probably null
R8271:Myo5b UTSW 18 74,760,261 (GRCm39) missense probably damaging 1.00
R8312:Myo5b UTSW 18 74,867,033 (GRCm39) missense probably damaging 1.00
R8383:Myo5b UTSW 18 74,777,049 (GRCm39) missense probably benign 0.05
R8384:Myo5b UTSW 18 74,875,273 (GRCm39) missense probably damaging 1.00
R8474:Myo5b UTSW 18 74,903,411 (GRCm39) missense probably damaging 1.00
R8825:Myo5b UTSW 18 74,892,169 (GRCm39) missense possibly damaging 0.79
R8846:Myo5b UTSW 18 74,841,043 (GRCm39) missense probably benign 0.04
R9236:Myo5b UTSW 18 74,853,934 (GRCm39) missense probably benign
R9283:Myo5b UTSW 18 74,777,149 (GRCm39) missense probably benign 0.16
R9370:Myo5b UTSW 18 74,760,246 (GRCm39) missense possibly damaging 0.54
R9506:Myo5b UTSW 18 74,877,831 (GRCm39) missense possibly damaging 0.82
R9523:Myo5b UTSW 18 74,861,968 (GRCm39) missense possibly damaging 0.89
R9622:Myo5b UTSW 18 74,848,017 (GRCm39) missense probably damaging 0.99
R9676:Myo5b UTSW 18 74,892,231 (GRCm39) missense probably benign 0.22
R9725:Myo5b UTSW 18 74,856,841 (GRCm39) missense probably benign
RF009:Myo5b UTSW 18 74,777,070 (GRCm39) missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74,877,820 (GRCm39) missense probably benign 0.35
Z1177:Myo5b UTSW 18 74,750,088 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACATTTATTCCCCAAGAGATGCTTC -3'
(R):5'- TGGGTTTCAGAGGTACCTCC -3'

Sequencing Primer
(F):5'- GAGATGCTTCTCACCAGGTTAC -3'
(R):5'- AAGAATGCCAGGGCTGCC -3'
Posted On 2018-04-02